GENATATOR-Caduceus-PS (Multispecies Gene Segmentation Model)
Overview
GENATATOR-Caduceus-PS is a DNA language model fine-tuned for gene segmentation directly from genomic DNA sequences.
The model performs nucleotide-level multilabel classification and predicts five gene structure classes:
| Class | Description |
|---|---|
| 5UTR | 5′ untranslated region |
| exon | exon |
| intron | intron |
| 3UTR | 3′ untranslated region |
| CDS | coding sequence |
The order of output classes in the model is:
["5UTR", "exon", "intron", "3UTR", "CDS"]
The model outputs one logit vector per nucleotide, allowing reconstruction of gene structures.
Model
Model name on Hugging Face:
genatator-caduceus-ps-multispecies
Architecture properties:
- backbone: Caduceus PS
- layers: 16
- hidden size: 512
- tokenization: single nucleotide
- output head: linear projection to 5 classes
- maximum supported sequence length: 250,000 nucleotides
Training Data
This model was fine-tuned on gene sequences only, not on complete genomes.
Training data includes:
- mRNA transcripts
- lncRNA transcripts
Dataset characteristics:
- one transcript per gene
- no intergenic regions
- multispecies training dataset
Each training sample corresponds to a single gene sequence.
Usage
from transformers import AutoTokenizer, AutoModelForTokenClassification
repo_id = "shmelev/genatator-caduceus-ps-multispecies"
tokenizer = AutoTokenizer.from_pretrained(
repo_id,
trust_remote_code=True,
)
model = AutoModelForTokenClassification.from_pretrained(
repo_id,
trust_remote_code=True,
)
model.eval()
Example Inference
import torch
from transformers import AutoTokenizer, AutoModelForTokenClassification
repo_id = "shmelev/genatator-caduceus-ps-multispecies"
tokenizer = AutoTokenizer.from_pretrained(repo_id, trust_remote_code=True)
model = AutoModelForTokenClassification.from_pretrained(repo_id, trust_remote_code=True)
sequences = [
"ACGTACGTACGTACGTACGTACGTACGT",
"TTGCGATCGATCGATCGATCGATCGATCGATCGATCGA",
]
enc = tokenizer(sequences)
input_ids = torch.tensor(enc["input_ids"])
with torch.no_grad():
outputs = model(input_ids=input_ids)
logits = outputs["logits"]
print("Input shape:", input_ids.shape)
print("Logits shape:", logits.shape)
Example output:
Input shape: torch.Size([2, sequence_length])
Logits shape: torch.Size([2, sequence_length, 5])
Each nucleotide receives 5 logits corresponding to the gene structure classes.
- Downloads last month
- 112