image imagewidth (px) 384 384 | text stringlengths 1.05k 7.68k |
|---|---|
\documentclass[crop,tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{arrows,decorations.pathmorphing,backgrounds,positioning}
\definecolor{echoreg}{HTML}{2cb1e1}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\definecolor{mymauve}{rgb}{0.58,0,0.82}
\usepackage{etoolbox}
\newtoggle{redraw}
\newtoggle{redraw2}
\tikzset{%... | |
\documentclass[crop,tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{arrows,decorations.pathmorphing,backgrounds,positioning}
\definecolor{echoreg}{HTML}{2cb1e1}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\definecolor{mymauve}{rgb}{0.58,0,0.82}
\usepackage{etoolbox}
\newtoggle{redraw}
\newtoggle{redraw2}
\tikzset{%... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{arrows,shapes}
\definecolor{mygreen}{rgb}{0,0.6,0}
\pgfdeclarelayer{background}
\pgfsetlayers{background,main}
\tikzstyle{vertex}=[circle,fill=black!25,minimum size=20pt,inner sep=0pt]
\tikzstyle{selected vertex} = [vertex, fill=red!24]
\tikzs... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{shapes, arrows}
\tikzstyle{block} = [rectangle, draw, fill=blue!20,
text width=5em, text centered, rounded corners, minimum height=4em]
\tikzstyle{block2} = [rectangle, draw, fill=blue!20,
text width=4em, text centered, rounded corners... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{snakes}
\definecolor{mygreen}{HTML}{006400}
\definecolor{mymauve}{rgb}{0.58,0,0.82}
\definecolor{mygold}{HTML}{B8860B}
\definecolor{mynavy}{HTML}{000080}
\begin{document}
\begin{tikzpicture}
\node at (0,0) {\tt GTGCATCTGACTCCTGAGGAGTAG};
\nod... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\tikzstyle{inputNode}=[draw,circle,minimum size=10pt,inner sep=0pt]
\tikzstyle{stateTransition}=[-stealth, thick]
\begin{document}
\begin{tikzpicture}
\node[draw,circle,minimum size=25pt,inner sep=0pt] (x) at (0,0) {$\Sigma$ $\sig... | |
\documentclass[crop,tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\definecolor{mymauve}{rgb}{0.58,0,0.82}
\definecolor{camdrk}{RGB}{0,62,114}
\begin{document}
\begin{tikzpicture}
\node[rectangle, draw, thick, olivegreen, minimum width=5em, minimum height=5em... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\tikzstyle{stateTransition}=[-stealth, thick]
\begin{document}
\begin{tikzpicture}
\node[rectangle, draw, minimum width=0.5cm,minimum height=2.5cm] (X) at (-2, 0) {$\vec{x}$};
\node[rectangle, draw, right=1.5em of X, text dep... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{amsmath}
\usetikzlibrary{decorations.pathmorphing, positioning}
\definecolor{echoreg}{HTML}{2cb1e1}
\definecolor{echodrk}{HTML}{0099cc}
\tikzstyle{mybox} = [text=black, very thick,
rectangle, rounded corners, inner sep=10pt, inner ysep=20pt]
\t... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning, shapes}
\begin{document}
\begin{tikzpicture}
\node (1) [draw, minimum width=15em, minimum height=2em, very thick, rounded rectangle] {};
\node (l1) [left=0em of 1] {$\vec{x}$};
\node (2) [above=3.9em of 1, draw, fill=lightgra... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{amsmath}
\usepackage{amssymb}
\usetikzlibrary{positioning, decorations.pathmorphing, shapes}
\begin{document}
\begin{tikzpicture}
\node[rounded rectangle, draw, thick, align=center] (A1) {Agent 1\\$(\theta_1', \psi_1')$};
\node[rounded rectangle... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{pgfplots}
\usetikzlibrary{automata, positioning}
\begin{document}
\begin{tikzpicture}[-stealth,very thick,node distance = 4cm,auto]
\node[state] (x) {$x$};
\node[state] (y) [above right of=x] {$y$};
\node[state] (z) [below right of=y] {$z$};
... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\node (X1) {$\vec{e}_{1}$};
\node[rectangle, right= 0.5em of X1] (x_dots_1) {$\dots$};
\node[right=0.5em of x_dots_1] (Xj) {$\vec{e}_{j}$};
\node[rectangle, right= 1em of Xj] (x_dots_2) {... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning,decorations.pathmorphing}
\begin{document}
\begin{tikzpicture}
\node[circle, thick, draw] (0) {$\vec{x}_i$};
\node[circle, thick, draw, above right=0.1em and 3em of 0] (1) {};
\node[circle, thick, draw, above right=0.8em and 0.5em... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning, matrix}
\tikzset{
tablet/.style={
matrix of nodes,
row sep=-\pgflinewidth,
column sep=-\pgflinewidth,
nodes={rectangle,draw=black,text width=1.25ex,align=center},
text height=1.25ex,
nodes in empty cells
},
texto/.st... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\draw[ultra thick, lightgray, dashed] (5.5, 2) -- (5.5, -2);
\node[circle,inner sep=0.3em,fill=red,very thick] (X) at (4.5, 0.5) {};
\node[circle,inner sep=0.3em,fill=gray,very thick] (Y) at... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\node[rectangle, draw, minimum width=2.2cm, minimum height=1cm] (FT) {\emph{new fts.}};
\node[rectangle, above =0em of FT, draw, minimum width=2.2cm] (IG) {\emph{input gate}};
\node[rectan... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{amsmath}
\usepackage{amssymb}
\usepackage{xcolor}
\usetikzlibrary{positioning, decorations.pathmorphing}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\begin{document}
\begin{tikzpicture}
\node[rectangle, minimum width=5em, minimum height=5em, fill=light... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{decorations.pathmorphing}
\definecolor{bluport}{HTML}{21ADFD}
\definecolor{orgport}{HTML}{E37322}
\definecolor{pplport}{HTML}{4F21E9}
\definecolor{redport}{HTML}{701315}
\begin{document}
\begin{tikzpicture}
\draw[thick, bluport] (0, 0) ellipse... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\definecolor{echodrk}{HTML}{0099cc}
\definecolor{olivegreen}{rgb}{0,0.6,0}
\definecolor{camdrk}{RGB}{0,62,114}
\begin{document}
\begin{tikzpicture}
\node[circle, gray, draw, very thick] (1) {$\vec{h}^\ell_1$};
\node[circle, echod... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}
\node[rectangle] (Y0) at (0, 0) {$\dots$};
\node[rectangle, draw, right=2em of Y0, minimum height=1cm, minimum width=1cm] (RNN) {LSTM$_\rightarrow$};
\node[rectangle, right=of RNN, draw, minim... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}[node distance=4cm, auto]
\node (00) {};
\node [right of=00] (l1) {Line 1};
\node [right of=l1] (01) {};
\draw[-stealth, very thick] (00) -- (l1) -- (01);
\node [below =1cm of 00] (10) {};
\... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\definecolor{mygreen}{rgb}{0,0.6,0}
\definecolor{mymauve}{rgb}{0.58,0,0.82}
\usetikzlibrary{arrows,shapes, decorations.pathmorphing,backgrounds,positioning}
\begin{document}
\begin{tikzpicture}
\node[circle, draw, thick] (h1) {$\vec{h}_1$};
\node[circle, d... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{tkz-graph}
\begin{document}
\begin{tikzpicture}[scale=0.8,every node/.style={scale=0.7},font=\tt]
\SetUpEdge[lw = 1.5pt,
color = black,
labelcolor = white]
\GraphInit[vstyle=Normal]
\SetGraphUnit{2.5}
\tikzset{VertexStyle/.a... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{positioning, decorations.pathmorphing}
\definecolor{mygreen}{rgb}{0,0.6,0}
\definecolor{echodrk}{HTML}{0099cc}
\begin{document}
\begin{tikzpicture}
\node[circle, draw, very thick, fill=echodrk] (11) {};
\node[below = 0.5em of 11] (11c) {$({\b... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{bm}
\usetikzlibrary{positioning, matrix}
\tikzset{
tablet/.style={
matrix of nodes,
row sep=-\pgflinewidth,
column sep=-\pgflinewidth,
nodes={rectangle,draw=black,text width=1.25ex,align=center},
text height=1.25ex,
text depth=0ex,
n... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{calc,decorations.pathmorphing,positioning}
\begin{document}
\begin{tikzpicture}
\node[very thick, densely dashed, draw=black,rectangle, minimum height=3.5em, minimum width=1.5em, xshift=15em, yshift=-1em, fill=lightgray] (rekt1) {};
\node... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{matrix, positioning}
\begin{document}
\begin{tikzpicture}
\matrix (mtr) [matrix of nodes,row sep=-\pgflinewidth, nodes={draw}]
{
0 & 1 & 1 & |[fill=red!30]| 1 & |[fill=red!30]| 0 & |[fill=red!30]| 0 & 0\\
0 & 0 & 1 & |[fill=red!30]| 1 & |... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usetikzlibrary{decorations.pathmorphing}
\definecolor{bluport}{HTML}{21ADFD}
\definecolor{orgport}{HTML}{E37322}
\definecolor{pplport}{HTML}{4F21E9}
\definecolor{redport}{HTML}{701315}
\begin{document}
\begin{tikzpicture}
\fill[pplport!15] (0, 0) ellipse (0... | |
\documentclass[crop, tikz]{standalone}
\usepackage{tikz}
\usepackage{pgfplots}
\begin{document}
\begin{tikzpicture}[cross/.style={path picture={
\draw[black] (path picture bounding box.south east) -- (path picture bounding box.north west) (path picture bounding box.south west) -- (path picture bounding box.north eas... | |
\documentclass[tikz]{standalone}
\pgfdeclarelayer{background}
\pgfsetlayers{background, main}
\begin{document}
\begin{tikzpicture}
\node[ball color=white, circle] (H1) at (-3.17, 1.39, -0.92) {H};
\node[ball color=white, circle] (H2) at (-3.31, 1.23, 0.84) {H};
\node[ball color=white, circle] (H3) at (-4.08, 0... | |
\documentclass[tikz]{standalone}
\usetikzlibrary{positioning}
\begin{document}
\begin{tikzpicture}[shorten >=2pt, thick, ->]
\node (X1) {$\vec e_1$};
\node[rectangle, below=3ex of X1] (x_dots_1) {$\dots$};
\node[below=3ex of x_dots_1] (Xj) {$\vec e_j$};
\node[rectangle, below=3ex of Xj] (x_dots_2) {$\dots$};... | |
\documentclass[svgnames,tikz]{standalone}
\def\unit{5}
\begin{document}
\begin{tikzpicture}[thick]
% Coordinates of initial, end and midpoints of transition to complexity
\coordinate (qea) at (-1/5*\unit,-5/12*\unit); % quantum effective action
\coordinate (ma1) at (2/5*\unit,1/2*\unit); % microscopic action 1... | |
\documentclass[tikz]{standalone}
\usepackage{tikz-3dplot}
\begin{document}
\tdplotsetmaincoords{70}{130}
\begin{tikzpicture}[tdplot_main_coords, scale=5]
%% Definition of the different styles
\tikzstyle{init} = [black] % initial base
\tikzstyle{prec} = [blue] % 1st intermediate base
\tikzstyle{nuta} = [red] ... | |
\documentclass[tikz]{standalone}
\usetikzlibrary{calc,positioning}
\begin{document}
\begin{tikzpicture}[
thick, text centered,
box/.style={draw, thin, minimum width=1cm},
func/.style={circle, text=white},
]
% x nodes
\node[box, fill=blue!20] (x1) {$x_1$};
\node[box, fill=blue!20, right of=x1] (x2... | |
\documentclass[tikz]{standalone}
\usetikzlibrary{matrix, positioning}
\begin{document}
\begin{tikzpicture}[
2d-arr/.style={matrix of nodes, row sep=-\pgflinewidth, column sep=-\pgflinewidth, nodes={draw}}
]
\matrix (mtr) [2d-arr] {
0 & 1 & 1 & |[fill=orange!30]| 1 & |[fill=orange!30]| 0 & |[fill=orange!30]... | |
\documentclass[tikz]{standalone}
\usetikzlibrary{calc,positioning}
\begin{document}
\begin{tikzpicture}[
thick, text centered,
box/.style={draw, thin, minimum width=1cm},
func/.style={circle, text=white},
input/.style={draw=red, very thick},
]
% x nodes
\node[box, input, fill=blue!20] (x1) {$x_... | |
\documentclass[tikz]{standalone}
\usetikzlibrary{positioning, arrows.meta, calc}
\begin{document}
\begin{tikzpicture}[
neuron/.style={circle,fill=black!25,minimum size=20,inner sep=0},
label/.style={font=\large\bfseries, minimum size=3em},
arrow/.style={>={LaTeX[width=5mm,length=5mm]}, ->, line width=1ex, gray,... | |
\documentclass[tikz]{standalone}
\usepackage{xstring}
\usetikzlibrary{calc,positioning}
\newcommand\drawNodes[2]{
% #1 (str): namespace
% #2 (list[list[str]]): list of labels to print in the node of each neuron
\foreach \neurons [count=\lyrIdx] in #2 {
\StrCount{\neurons}{,}[\layerLen] % use xstring packag... | |
\documentclass[tikz]{standalone}
\usetikzlibrary{positioning}
\def\layersep{2}
\def\nodesep{1.5}
\begin{document}
\begin{tikzpicture}[
node/.style={circle, draw, thick},
]
\foreach \y in {1,...,5}{
\node[node] (i\y) at (0,\nodesep*\y) {};
\node[node, right=\layersep of i\y] (h1\y) {};
\nod... | |
\documentclass[tikz,svgnames]{standalone}
\usetikzlibrary{patterns}
\begin{document}
\begin{tikzpicture}[
very thick,
q0/.style={->,DarkBlue,semithick,yshift=5pt,shorten >=5pt,shorten <=5pt},
cross/.style={
path picture={
\draw[black,thick]
(path picture bounding box.south ... | |
\documentclass[tikz]{standalone}
\usetikzlibrary{intersections,decorations.markings}
\begin{document}
\begin{tikzpicture}
\node [style={circle,minimum width=4cm,fill=gray!20},draw=black,name path=A,decoration={markings,mark=at position 0.175 with {\arrow[ultra thick]{>}}},postaction={decorate}] at (0,0) (A) {};
... | |
\documentclass[tikz]{standalone}
\usetikzlibrary{calc}
\def\layersep{3cm}
\newcommand\nn[1]{
% Input layer
\foreach \y in {1,...,2}
\node[neuron, fill=green!40] (i\y-#1) at (0,\y+1) {$i\y$};
% Hidden layer
\foreach \y in {1,...,4}
\path node[neuron, fill=blue!40] (h\y-#1) at (\layerse... | |
\documentclass{standalone}
\usepackage{circuitikz}
\usetikzlibrary{3d,positioning,decorations.markings}
\tikzset{
decoration={%
markings,%
mark=at position 0.05 with {\arrow[black]{stealth};},%
mark=at position 0.4 with {\arrow[black]{stealth};},%
mark=at position 0.6 with {\arrow[black]{stealth};},%
mark=a... | |
\documentclass[tikz,svgnames]{standalone}
\usepackage{amsmath,amssymb}
\usetikzlibrary{decorations.markings}
\begin{document}
\begin{tikzpicture}[
thick, font = \scriptsize,
circ/.style ={circle, fill = gray, draw = gray, inner sep = 1pt}
]
\def\yaxis{2}
\draw [<->] (-2, 0) -- (2, 0) node (from)[ancho... | |
\documentclass[tikz]{standalone}
\usetikzlibrary{tqft,calc}
\begin{document}
\begin{tikzpicture}[
every tqft/.append style={
transform shape, rotate=90, tqft/circle x radius=7pt,
tqft/boundary separation=1cm, tqft/view from=incoming
}
]
% cobordism at upper left
\pic[
tqft/cylind... | |
\documentclass[tikz]{standalone}
\usepackage{chemformula} % used for \ch and \text
\usetikzlibrary{positioning, calc, decorations.pathreplacing}
\begin{document}
\begin{tikzpicture}[very thick, vertex/.style={draw, circle, minimum size=3ex}]
\draw (0,0) coordinate[vertex, fill=teal, label=right:$h_\text{La}$] (h_... | |
\documentclass[tikz]{standalone}
\usepackage{forest}
\usetikzlibrary{fit,positioning}
\tikzset{
red arrow/.style={
midway,red,sloped,fill, minimum height=3cm, single arrow, single arrow head extend=.5cm, single arrow head indent=.25cm,xscale=0.3,yscale=0.15,
allow upside down
},
black arrow/.style 2 arg... | |
\documentclass[tikz,svgnames]{standalone}
\usepackage{mathtools}
\usetikzlibrary{calc}
\renewcommand\vec[1]{\boldsymbol{#1}}
\begin{document}
\begin{tikzpicture}[
label/.style={black,draw,fill=white,ultra thin},
vector/.style={ultra thick,-latex,DarkBlue}
]
\def\xmin{-2} \def\xmax{6}
\def\ymin{-2} \d... | |
\documentclass[border=3pt,tikz]{standalone}
\usepackage{mathtools}
\usetikzlibrary{decorations.markings}
\colorlet{Ecolor}{orange!90!black}
\colorlet{pluscolor}{red!60!black}
\colorlet{minuscolor}{blue!60!black}
\tikzstyle{anode}=[top color=red!20, bottom color=red!50]
\tikzstyle{cathode}=[top color=blue!20, bottom c... | |
\documentclass[tikz,svgnames,border={0 2}]{standalone}
\usepackage{mathtools}
\usetikzlibrary{positioning,arrows,fit}
\renewcommand\vec[1]{\boldsymbol{#1}}
\begin{document}
\begin{tikzpicture}[
box/.style={rectangle,draw,fill=DarkGray!20,node distance=1cm,text width=15em,text centered,rounded corners,minimum he... | |
\documentclass[tikz]{standalone}
\usepackage{pgfplots}
\pgfplotsset{compat=newest}
\tikzset{
canvas/.style={draw,left color=blue!35!black,right color=white},
sign/.style={align=center,fill=white,fill opacity=0.2,text opacity=1,text=white},
axis label/.style={midway,below,sloped}
}
\def\datapoint(#1,#2,#3... | |
\documentclass[tikz,svgnames]{standalone}
\usepackage[utf8]{inputenc}
\usepackage[T1]{fontenc}
\usetikzlibrary{positioning,decorations.text}
\renewcommand{\familydefault}{\sfdefault}
\tikzset{
entity/.style={fill=#1!70,text=white,rounded corners,inner sep=1ex,font=\bfseries},
action/.style={->,thick,postact... | |
\documentclass[tikz]{standalone}
\usepackage{xstring}
\usetikzlibrary{fit,positioning}
\newcommand\drawNodes[2]{
% #1 (str): namespace
% #2 (list[list[str]]): list of labels to print in the node of each neuron
\foreach \neurons [count=\lyrIdx] in #2 {
\StrCount{\neurons}{,}[\layerLen] % use xstring package... | |
\documentclass[tikz]{standalone}
\usepackage{mathtools}
\usetikzlibrary{positioning,arrows}
\begin{document}
\begin{tikzpicture}[
g/.style={rectangle,draw,rounded corners,minimum height=6em,inner sep=1em,font=\Huge},
w/.style={font=\Huge},
c/.style={node distance=15ex,align=left,font=\huge},
a/.style... | |
\documentclass[tikz]{standalone}
\usepackage{mathtools}
\let\Im\relax
\DeclareMathOperator{\Im}{Im}
\let\Re\relax
\DeclareMathOperator{\Re}{Re}
\usetikzlibrary{decorations.markings,positioning}
\providecommand{\poles}{
\node (poles) at (2.5,1.5) {poles of $h(p_0)$};
\draw[fill]
(1.5,3) coordinate [circle,fill... | |
\documentclass[tikz]{standalone}
\usepackage{amsmath}
\usetikzlibrary{tqft,calc}
\begin{document}
\begin{tikzpicture}[
every tqft/.append style={
transform shape, rotate=90, tqft/circle x radius=7pt,
tqft/circle y radius=0pt, tqft/boundary separation=1cm
}
]
% cobordism at upper left
... | |
\documentclass[tikz]{standalone}
\usetikzlibrary{positioning}
\newcommand{\distro}[4][40]{
\begin{tikzpicture}[thick]
\draw[dashed, dash pattern={on 2.3 off 2}] (0, .4) circle (12mm);
\draw[blue!60!black, very thick] plot[variable=\t, domain=-1:1, samples=#1] ({\t}, {#2 * exp(-10*(\t)^2) + #3 * exp(-60*(\t-... | |
% Original TikZ source: https://fleuret.org/git-extract/tex/single-attention.tex
% Any copyright is dedicated to the Public Domain.
% https://creativecommons.org/publicdomain/zero/1.0
\documentclass[tikz]{standalone}
\usepackage{mathtools}
\def\transpose{^{\top}}
\DeclareMathOperator\softmax{softmax}
\DeclareMathOpe... | |
\documentclass[tikz]{standalone}
\usetikzlibrary{patterns,decorations.markings}
\tikzset{
dressed/.style={fill=white,postaction={pattern=north east lines}},
momentum/.style={->,semithick,yshift=5pt,shorten >=5pt,shorten <=5pt},
loop/.style 2 args={thick,decoration={markings,mark=at position {#1} with {\arrow{>}... | |
\documentclass[border=15pt]{standalone}
\usepackage{tikz}
\usetikzlibrary{calc,patterns,decorations.pathmorphing,decorations.markings}
\begin{document}
\begin{tikzpicture}[every node/.style={draw,outer sep=0pt,thick}]
\tikzstyle{spring}=[thick,decorate,decoration={zigzag,pre length=0.3cm,post length=0.3cm,segment l... | |
\documentclass{standalone}
\usepackage{tikz}
\begin{document}
\pagestyle{empty}
\def\layersep{3cm}
\def\nodeinlayersep{1.5cm}
\begin{tikzpicture}
[
shorten >=1pt,->,
draw=black!50,
node distance=\layersep,
every pin edge/.style={<-,shorten <=1pt},
neuron/.style={circle,fill=black!25,minimum size... | |
\documentclass[margin=5mm]{standalone}
\usepackage{tikz}
\usetikzlibrary{arrows.meta}% Unecessary (only for the second example)
\tikzset{
timeline/.style={-latex}%
,timeline style/.style={timeline/.append style={#1}}%
,year label/.style={below}%
,year label style/.style={year label/.append style={#1}}%
,year... | |
% Author: Izaak Neutelings (June 2017)
% taken from https://tex.stackexchange.com/questions/159445/draw-in-cylindrical-and-spherical-coordinates
\documentclass[border=10pt]{standalone}
\usepackage{tikz}
\usepackage{tikz-3dplot}
\tikzset{>=latex} % for LaTeX arrow head
%% split figures into pages
%\usepackage[active,... |
End of preview. Expand in Data Studio
No dataset card yet
- Downloads last month
- 4