reference stringlengths 7 774 ⌀ | aptamer_chemistry stringclasses 21
values | aptamer_name stringlengths 1 164 | target_name stringlengths 2 1.2k ⌀ | aptamer_sequence stringlengths 2 380 | origin stringclasses 6
values | target_chemistry stringclasses 11
values | external_id stringclasses 509
values | target_sequence stringclasses 357
values | new_affinity stringlengths 3 193 ⌀ |
|---|---|---|---|---|---|---|---|---|---|
Yu, H., Canoura, J., Guntupalli, B., Lou, X., & Xiao, Y. (2017). A cooperative-binding split aptamer assay for rapid, specific and ultra-sensitive fluorescence detection of cocaine in saliva. Chemical Science, 8(1), 131–141. doi:10.1039/c6sc01833eMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecifici... | DNA | CBSA-5335 LF (ID# 8119) | Cocaine | CTCCTTCAACGAAGTGGGTCTCCTTCAACGAAGTGGGTCTC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 36 nM |
Yang, M., Peng, Z., Ning, Y., Chen, Y., Zhou, Q., Deng, L., 2013. Highly specific and cost-efficient detection of salmonella paratyphi a combining aptamers with single-walled carbon nanotubes. Sensors 13, 6865–6881.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immun... | DNA | Apt22 (ID# 8212) | Salmonella Paratyphi A | ATGGACGAATATCGTCTCCCAGTGAATTCAGTCGGACAGCG | https://www.aptagen.com/apta-index/ | Cells | null | null | 47 nM |
Gebhardt, K., et al. "RNA Aptamers to S-Adenosylhomocysteine: Kinetic Properties, Divalent Cation Dependency, and Comparison with Anti-S-adenosylhomocysteine Antibody." Biochemistry, 39 (2000): 7255-7265.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin ... | RNA | S-adenosyl homocysteine (CTH-5) (ID# 7514) | S-adenosyl homocysteine | GGGCGGAUGAGACGCUUGGCGUGUGCUGUGGAGAGUCAUCCG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 0.1 nM |
X Tan et al. Molecular beacon aptamers for direct and universal quantitation of recombinant proteins from cell lysates. Anal. Chem. [published online ahead of print August 23, 2012]. doi: 10.1021/ac301764qMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin ... | DNA | HMBA (aptabeacon) (ID# 7716) | 6X His-tag | ACAGGTTGGTCTGGTTGGGTTTGGCTCCTGTGTACGCAACCTGCG | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
L. Zhat et al. An RNA aptamer-based microcantilever sensor to detect the inflammatory marker, mouse lipocalin-2. Anal. Chem. 84(2012):8763-8770.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Mouse Lipocalin-2 (mLcn2) (Oligo 569) (ID# 7744) | Mouse Lipocalin-2 (mLcn2) | CCUCCGGCUCAUACCUUUUCGAAGACAAGCUUCGACAGGAGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 340 nM |
Han, S. R. and Lee, S. "In Vitro Selection of RNA Aptamer Specific to Salmonella Typhimurium." Journal of Microbiology and Biotechnology, 23.6(2013): 878-84.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Salmonella Typhimurium OmpC Protein (T-2) (ID# 7876) | S. Typhimurium OmpC Protein | UAGUGUGAGAGCCGUGAGUGAAAGGCCGCGACAAAGAUCGGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 20 nM |
Wang H, Li X, Lai LA, Brentnall TA, Dawson DW, Kelly KA, Chen R, Pan S. X-aptamers targeting Thy-1 membrane glycoprotein in pancreatic ductal adenocarcinoma. Biochimie. 2021 Feb;181:25-33. doi: 10.1016/j.biochi.2020.11.018. Epub 2020 Nov 23. PMID: 33242496; PMCID: PMC7863625.Miyakawa, Shin, et al. "Structural and molec... | DNA | XA-A9 (ID# 8093) | Thy-1 membrane glycoprotein | TTGCCCACAGATCTGTGGAAGCCGAACCGCGTGCTAGTCGTG | https://www.aptagen.com/apta-index/ | Protein | null | null | 15 nM |
Wang H, Li X, Lai LA, Brentnall TA, Dawson DW, Kelly KA, Chen R, Pan S. X-aptamers targeting Thy-1 membrane glycoprotein in pancreatic ductal adenocarcinoma. Biochimie. 2021 Feb;181:25-33. doi: 10.1016/j.biochi.2020.11.018. Epub 2020 Nov 23. PMID: 33242496; PMCID: PMC7863625.Miyakawa, Shin, et al. "Structural and molec... | DNA | XA-B216 (ID# 8094) | Thy-1 membrane glycoprotein | TTGCCCACCTCCCTGTGCGGGCCACAGAGCAGCAGTGTCGTG | https://www.aptagen.com/apta-index/ | Protein | null | null | 36 nM |
Wang H, Li X, Lai LA, Brentnall TA, Dawson DW, Kelly KA, Chen R, Pan S. X-aptamers targeting Thy-1 membrane glycoprotein in pancreatic ductal adenocarcinoma. Biochimie. 2021 Feb;181:25-33. doi: 10.1016/j.biochi.2020.11.018. Epub 2020 Nov 23. PMID: 33242496; PMCID: PMC7863625.Miyakawa, Shin, et al. "Structural and molec... | DNA | XA-B217 (ID# 8095) | Thy-1 membrane glycoprotein | TTGCCCACCGTACTGTGCAGGTCGAACTACAGGCACGTCGTG | https://www.aptagen.com/apta-index/ | Protein | null | null | 2 nM |
Song Z, Mao J, Barrero RA, Wang P, Zhang F, Wang T. Development of a CD63 Aptamer for Efficient Cancer Immunochemistry and Immunoaffinity-Based Exosome Isolation. Molecules. 2020 Nov 27;25(23):5585. doi: 10.3390/molecules25235585. PMID: 33261145; PMCID: PMC7730289.Miyakawa, Shin, et al. "Structural and molecular basis ... | DNA | CD63-1 (ID# 8097) | CD63 | TAACACGACAGACGTTCGGAGGTCGAACCCTGACAGCGTGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 38.71 nM |
Niu, C., Ding, Y., Zhang, C., & Liu, J. (2022). Comparing two cortisol aptamers for label-free fluorescent and colorimetric biosensors. Sensors & Diagnostics, 1(3), 541–549. https://doi.org/10.1039/d2sd00042cMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobul... | DNA | CSS.1 (ID# 8201) | Cortisol | GACGACGCCCGCATGTTCCATGGATAGTCTTGACTAGTCGTC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 245 nM |
Chen and Gold. "Selection of High-Affinity RNA Ligands to Reverse Transcriptase: Inhibition of cDNA Synthesis and RNase H Activity." Journal of Biochemistry, 33(1994): 8746-8756.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008):... | RNA | Avian Myeloblastosis Virus (a.1.1) (ID# 7574) | Avian Myeloblastosis Virus (AMV) RT | CGUCCCGUGCGCAAAAGUUCUUAGCGCUAGCAGUCCUAGUUGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.5 nM |
Hong-Ru Liang, Gui-Qiu Hu, Xiang-Hong Xue, Lu Li, Xue-Xing Zheng,Yu-Wei Gao, Song-Tao Yang, Xian-Zhu Xia, "Selection of an aptamer against rabies virus: A new class of molecules with antiviral activity". Virus Research 184 (2014) 7-13.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA ap... | DNA | GE54 (ID# 7909) | Rabies Virus glycoprotein(RABV) | TATTTTTATATTTGTTTGACAGTCGCTTGCTTGTGTAGGCGTT | https://www.aptagen.com/apta-index/ | Protein | null | null | 307 nM |
Yang, Z. et al. Community Sewage Sensors towards Evaluation of Drug Use Trends: Detection of Cocaine in Wastewater with DNA-Directed Immobilization Aptamer Sensors. Sci. Rep. 6, 21024; doi: 10.1038/srep21024 (2016).Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immun... | DNA | Cocaine Aptamer (ID# 7966) | Cocaine | GACAAGGATAAATCCTTCAATGAAGTGGGTCACTCATCTGTGA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | Not Mentioned in Database |
Zhang, L., Wang, S., Yang, Z., Hoshika, S., Xie, S., Li, J., …Tan, W. (2019). An Aptamer‐Nanotrain Assembled from 6‐Letter DNA Delivers Doxorubicin Selectively to Liver Cancer Cells. Angewandte Chemie. doi:10.1002/ange.201909691Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer t... | DNA | LZH5B (ID# 8024) | HepG2 Liver Cancer Cells | GTGACGCAGCAGCTACTTGGGCCCTGGTTTCTGTGCTGGACAC | https://www.aptagen.com/apta-index/ | Cells | null | null | 12 nM |
Kwon, J., Narayan, C., Kim, C., Han, M. J., Kim, M., & Jang, S. K. (2019). Development of a Subtype-Specific Diagnostic System for Influenza Virus H3N2 Using a Novel Virus-Based Systematic Evolution of Ligands by Exponential Enrichment (Viro-SELEX). Journal of Biomedical Nanotechnology, 15(7), 1609–1621. https://doi.or... | DNA | Aptamer A14 (ID# 8033) | HA protein of CJ01 H1N1 Influenza Virus | CCTGCCTTTGGCAGCCGGGCGAAGGCAACCCGACACCGACAGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.98 nM |
Famulok, M., " Molecular Recognition of Amino Acids by RNA-Aptamers: An L-Citrulline Binding RNA Motif and its Evolution into an L-Arginine Binder." Journal of the American Chemical Society, 116 (1994): 1698-1706.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immuno... | RNA | L-Citrulline (44Cit11) (ID# 7517) | L-Citrulline | GACGAGAAGGAGUGCUGGUUAUACUAGCGGUUAGGUCACUCGUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 68 µM |
M S Wang et al. "C-reactive protein (CRP) aptamer binds to monomeric but not pentameric form of CRP." Analytical and Bioanalytical Chemistry, 401(2011): 1309-1318. M S Wang and S M Reed. Direct visualization of electrophoretic mobility shift assays using nanoparticle-aptamer conjugates. Electrophoresis. 33(2012): 3... | RNA | C-Reactive Protein Monomer (ID# 7565) | Monomeric C-Reactive Protein (CRP) | GCCUGUAAGGUGGUCGGUGUGGCGAGUGUGUUAGGAGAGAUUGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 187.7 nM |
Famulok, M., " Molecular Recognition of Amino Acids by RNA-Aptamers: An L-Citrulline Binding RNA Motif and its Evolution into an L-Arginine Binder." Journal of the American Chemical Society, 116 (1994): 1698-1706.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunog... | RNA | L-Arginine(44Arg11) (ID# 7583) | L-Arginine | GACGAGAAGGAGCGCUGGUUCUACUAGCAGGUAGGUCACUCGUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 60 nM |
Levesque et al. "In vitro selection and characterization of RNA aptamers binding thyroxine hormone." Biochemical Journal, 403(2007): 129-138.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Thyroxine (ApT4-A’) (ID# 7585) | Thyroxine | GGUGGAGGGGGACGUGCUGCAUCCGCAGUGCGUCUUGGGUUGUG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 50 µM |
A Bini, M Mascini, et al. Development of an optical RNA-based aptasensor for C-reactive protein. Anal. Bioanal. Chem. 390(2008): 1077-1088Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | C-Reactive Protein (ID# 7819) | C-Reactive Protein (CRP) | GCCUGUAAGGUGGUCGGUGUGGCGAGUGUGUUAGGAGAGAUUGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 125 nM |
Huang, M., Song, J., Huang, P., Chen, X., Wang, W., Zhu, Z., Song, Y., & Yang, C. (2019). Molecular Crowding Evolution for Enabling Discovery of Enthalpy-Driven Aptamers for Robust Biomedical Applications. Analytical Chemistry, 91(16), 10879–10886. https://doi.org/10.1021/acs.analchem.9b02697Miyakawa, Shin, et al. "Str... | DNA | Enthalpy Driven Aptamer SYL-H2C (ID# 8044) | EpCAM | GAGCTCGGGGTTTGGGGGTTCGGGGTCGGTTCGGTTTCTT | https://www.aptagen.com/apta-index/ | Protein | null | null | 34.7 nM |
Yang KA, Barbu M, Halim M, et al. Recognition and sensing of low-epitope targets via ternary complexes with oligonucleotides and synthetic receptors. Nat Chem. 2014;6(11):1003-1008. doi:10.1038/nchem.2058Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G... | DNA | Glucose-bisboronic acid aptamer-sensor (ID# 8045) | Glucose | CTCTCGGGACGACAGCCGAGTTGATTCAACAGCCGAGTCGTCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 5 nM |
Xiong, H., Yan, J., Cai, S., He, Q., Peng, D., Liu, Z., & Liu, Y. (2019). Cancer protein biomarker discovery based on nucleic acid aptamers. International Journal of Biological Macromolecules. doi:10.1016/j.ijbiomac.2019.03.165Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to... | DNA | S3 (ID# 8057) | CD109 | TCTGAGAATAGTGGTTTGCTGTATGGTGGGCGTTGAAAGAGGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 10.5332 - 13.3326 nM |
Qiao, N., Li, J., Wu, X., Diao, D., Zhao, J., Li, J., … Lou, X. (2019). Speeding up in vitro Discovery of Structure-Switching Aptamers via Magnetic Cross-Linking Precipitation. Analytical Chemistry. doi:10.1021/acs.analchem.9b00081Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptame... | DNA | Tb-L8 (ID# 8062) | Thrombin | GGTGTGGGCGACATGGGGGTTGGTGGTGTAGGAGCGCCAT | https://www.aptagen.com/apta-index/ | Protein | null | null | 33 nM |
Lin et al. "Peptide conjugation to an in vitro-selected DNA ligand improves enzyme inhibition." PNAS, 92(1995): 11044-11048.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Human Neutrophil Elastase (DNA I) (ID# 7576) | Human Neutrophil Elastase (HNE) | TAGCGATACTGCGTGGGTTGGGGCGGGTAGGGCCAGCAGTCTCGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 17 nM |
Aptamer Selection Reference: Wiegand, T.W., et al. "High-Affinity Oligonucleotide Ligands to Human IgE Inhibit Binding to FCE Receptor I." Journal of Immunology, 157 (1996): 221-230 Liss, M., et al. "An Aptamer-Based Quartz Crystal Protein Biosensor." Anal. Chem.,74 (2002): 4488-4495.Miyakawa, Shin, et al. "Structural... | DNA | Anti-IgE Aptamer, D 17.4 ext (ID# 7666) | IgE (human) | GCGCGGGGCACGTTTATCCGTCCCTCCTAGTGGCGTGCCCCGCGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.6 nM |
Kim HR, Song MY, Chan Kim B. Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method. Analytical Biochemistry. 2020 Feb;591:113542. DOI: 10.1016/j.ab.2019.113542.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(200... | DNA | 20-10 (ID# 8013) | E. coli | TATGGCGTGGCAAGCTTGGCCCGCTTCTCAAGCATGGTTATCTAC | https://www.aptagen.com/apta-index/ | Cells | null | null | 10.1 nM |
Lee, K.H., Zeng, H. A general double library SELEX strategy for aptamer selection using unmodified nonimmobilized targets. Anal Bioanal Chem 409, 5081–5089 (2017).Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | VA 6 (ID# 8014) | VEGF165 | CGACCTTAGCCTATGTTTTCTCTACCGGCTATGTTACGCGGGTCG | https://www.aptagen.com/apta-index/ | Protein | null | null | 71 nM |
Kim HR, Song MY, Chan Kim B. Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method. Analytical Biochemistry. 2020 Feb;591:113542. DOI: 10.1016/j.ab.2019.113542.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(200... | DNA | 20-7 (ID# 8015) | E. coli | CGCAATACCAAAGTGGCGAGAGCGCTGTCTTGAGTGAGTGGTTGG | https://www.aptagen.com/apta-index/ | Cells | null | null | 8.0 nM |
Kim HR, Song MY, Chan Kim B. Rapid isolation of bacteria-specific aptamers with a non-SELEX-based method. Analytical Biochemistry. 2020 Feb;591:113542. DOI: 10.1016/j.ab.2019.113542.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(200... | DNA | 20-5 (ID# 8016) | E. coli | ATTTCGCCCCCGTGTTCCGACTGGTATCTTCACGTCTTCGAGTGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 3.9 nM |
Trachman, R. J., Autour, A., Jeng, S. C. Y., Abdolahzadeh, A., Andreoni, A., Cojocaru, R., … Ferré-D’Amaré, A. R. (2019). Structure and functional reselection of the Mango-III fluorogenic RNA aptamer. Nature Chemical Biology, 15(5), 472–479. doi:10.1038/s41589-019-0267-9Miyakawa, Shin, et al. "Structural and molecular ... | RNA | Mango III A10U (ID# 8021) | Thiazole Orange - Biotin (TO1-Biotin) | GGCACGUACGAAGGAAGGUUUGGUAUGUGGUAUAUUCGUACGUGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 1.7 nM |
Kwon, J., Narayan, C., Kim, C., Han, M. J., Kim, M., & Jang, S. K. (2019). Development of a Subtype-Specific Diagnostic System for Influenza Virus H3N2 Using a Novel Virus-Based Systematic Evolution of Ligands by Exponential Enrichment (Viro-SELEX). Journal of Biomedical Nanotechnology, 15(7), 1609–1621. https://doi.or... | DNA | Aptamer A1 (ID# 8032) | HA protein of CJ01 H1N1 Influenza Virus | CCTGCCTTTGGAACCGACCGCCAGGCCGAGGAAAGGCACCGACAGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.36 nM |
Yu, H., Luo, Y., Alkhamis, O., Canoura, J., Yu, B., & Xiao, Y. (2021). Isolation of Natural DNA Aptamers for Challenging Small-Molecule Targets, Cannabinoids. Analytical chemistry, 93(6), 3172–3180. https://doi.org/10.1021/acs.analchem.0c04592Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity o... | DNA | XA1 (ID# 8158) | XLR-11 | CTTACGACTGTGGTCGGGTGGTGGGCCTCTAGAGGGGTGTCGTAAG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 310 nM |
Haixiang Yu, Weijuan Yang, Obtin Alkhamis, Juan Canoura, Kyung-Ae Yang, Yi Xiao, In vitro isolation of small-molecule-binding aptamers with intrinsic dye-displacement functionality, Nucleic Acids Research, Volume 46, Issue 8, 4 May 2018, Page e43, https://doi.org/10.1093/nar/gky026Miyakawa, Shin, et al. "Structural and... | DNA | Aptamer MA (ID# 8176) | methylenedioxypyrovalerone (MDPV) | CTTACGACTCAGGCATTTTGCCGGGTAACGAAGTTACTGTCGTAAG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 7 nM |
Sun, M., Liu, S., Wei, X., Wan, S., Huang, M., Song, T., Lu, Y., Weng, X., Lin, Z., Chen, H., Song, Y., & Yang, C. (2021). Aptamer Blocking Strategy Inhibits SARS-CoV-2 Virus Infection. Angewandte Chemie (International ed. in English), 60(18), 10266–10272. https://doi.org/10.1002/anie.202100225Miyakawa, Shin, et al. "S... | DNA | CoV2-6C3 (ID# 8195) | SARS-CoV-2 Spike Protein RBD | CGCAGCACCCAAGAACAAGGACTGCTTAGGATTGCGATAGGTTCGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 44.78 nM |
S.H. Ohk et al. Antibody-aptamer functionalized fibre-optic biosensor for specific detection of Listeria monocytogenes from food. J. Appl. Microbiol. 109(2010): 808-817.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163... | DNA | Internalin A of Listeria monocytogenes (ID# 7769) | Internalin A (InlA) | ATCCATGGGGCGGAGATGAGGGGGAGGAGGGCGGGTACCCGGTTGAT | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | S21 (ID# 8065) | Cas9 | GAGGCTCTCACATCGCGCCTTTCCCCAGCTTTCGGTGTGAGAGCCTC | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.63 nM |
Gao T , Ding P , Li W , Wang Z , Lin Q , Pei R . Isolation of DNA aptamers targeting N-cadherin and high-efficiency capture of circulating tumor cells by using dual aptamers. Nanoscale. 2020 Nov 19;12(44):22574-22585. doi: 10.1039/d0nr06180h. PMID: 33174555.Miyakawa, Shin, et al. "Structural and molecular basis for hyp... | DNA | NC3S (ID# 8079) | N‑Cadherin | TTGCACTATGTTTTAGCTAGGGTTCCCTCCGGAGATAGTAAGTGCAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 20.08 ± 0.72 nM |
Yu XX, Ge KL, Liu N, Zhang JY, Xue ML, Ge YL. Selection and Characterization of a Novel DNA Aptamer, Apt-07S Specific to Hepatocellular Carcinoma Cells. Drug Des Devel Ther. 2020 Apr 20;14:1535-1545. doi: 10.2147/DDDT.S244149. PMID: 32368012; PMCID: PMC7182459.Miyakawa, Shin, et al. "Structural and molecular basis for ... | DNA | Apt-07S (ID# 8108) | HepG2 (Kd = 194.7nM) and SMMC-7721 (Kd = 224.2nM) | GTACTGTCAATTGGAAGTGGTGTTACGTTGTGTAGTCAAATCAGTGC | https://www.aptagen.com/apta-index/ | Cells | null | null | 194.7 and 224.2 nM |
Yu, H., Luo, Y., Alkhamis, O., Canoura, J., Yu, B., & Xiao, Y. (2021). Isolation of Natural DNA Aptamers for Challenging Small-Molecule Targets, Cannabinoids. Analytical chemistry, 93(6), 3172–3180. https://doi.org/10.1021/acs.analchem.0c04592Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity o... | DNA | THC1.2 (ID# 8156) | THC | CTTACGACCCAGGGGGGTGGACAGGCGGGGGTTAGGGGGGTCGTAAG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 40 nM |
Lee, Seong-Wook and Sullenger, Bruce. "Isolation of a nuclease-resistant decoy RNA that can protect human acetylcholine receptors from myasthenic antibodies." Nature Biotechnology, 15 (1997): 41-45.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA... | 2'-NH2-RNA | Acetylcholine Receptor Antibody (mAB198) (SE RNA VII) (ID# 7482) | Acetylcholine Receptor Antibody (mAB198) | UGGGCCGGAGGUUAGCUUGCCCAUGGCAAGCAGGGCGCCACGGACCCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 60 nM |
Lee and Sullenger. "Isolation of a nuclease-resistant decoy RNA that can protect human acetylcholine receptors from myasthenic antibodies." Nature Biotechnology, 15(1997):Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-11... | 2'-NH2-RNA | Anti-acetylcholine Autoantibodies (SE RNA) (ID# 7538) | Anti-acetylcholine Autoantibodies | UGGGCCGGAGGUUAGCUUGCCCAUGGCAAGCAGGGCGCCACGGACCCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 60 nM |
Tang et al. "Selection of Aptamers for Molecular Recognition and Characterization of Cancer Cells." Analytical Chemistry, 79(2007): 4900-4907.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Ramos Cells (TD05) (ID# 7664) | Ramos Cells (B-cell lymphoma cell line) | AACACCGTGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCCGGTG | https://www.aptagen.com/apta-index/ | Cells | null | null | 74.7 nM |
Lin et al. "Recognition Imaging of Acetylated Chromatin Using a DNA Aptamer." Biophysical Journal, 97(2009): 1804-07.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Histone (H4K16Ac) (ID# 7722) | H4K16Ac | AGACGTAAGTTAATTGGACTTGGTCGTGTGCGGCACAGCGATTGAAAT | https://www.aptagen.com/apta-index/ | Peptide | null | null | 47 nM |
Meng, Hsein-Wei, and John Pagano. "Discovering Aptamers by Cell-SELEX against Human Soluble Growth Factors Ectopically Expressed on Yeast Cell Surface." Plos-One 9.3 (2014): 1-12. Print.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,... | DNA | hVap1_Stem (ID# 7922) | VEGF | TCTAGCCCACTGCATAGAGGTAGCCACGTATGTTCGTGGCTACCGGTG | https://www.aptagen.com/apta-index/ | Protein | null | null | 5.6 nM |
Yang K, Pei R, Stefanovic D, Stojanovic M.N. (2011) Optimizing Cross-reactivity with Evolutionary Search for Sensors. J. Am. Chem. Soc.134:1642-1647. | DNA | Beta-Estradiol Aptamer (BES.1) (ID# 7961) | Beta-Estradiol (Estrogen) | GGCTCTCGGGACGACATGGATTTTCCATCAACGAAGTGCGTCCGTCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 6 µM |
Selection of DNA Aptamers against Epithelial Cell Adhesion Molecule for Cancer Cell Imaging and Circulating Tumor Cell Capture Yanling Song, Zhi Zhu, Yuan An, Weiting Zhang, Huimin Zhang, Dan Liu, Chundong Yu, Wei Duan, and Chaoyong James Yang Analytical Chemistry 2013 85 (8), 4141-4149 DOI: 10.1021/ac400366bMiyakaw... | DNA | Epithelial Cell Adhesion Molecule (EpCAM) SYL3C (ID# 7980) | Cancer Cells | CACTACAGAGGTTGCGTCTGTCCCACGTTGTCATGGGGGGTTGGCCTG | https://www.aptagen.com/apta-index/ | Cells | null | null | 38 nM |
Boyacioglu, O., Stuart, C. H., Kulik, G., & Gmeiner, W. H. (2013). Dimeric DNA Aptamer Complexes for High-capacity–targeted Drug Delivery Using pH-sensitive Covalent Linkages. Molecular Therapy - Nucleic Acids, 2, e107. doi:10.1038/mtna.2013.37Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity ... | DNA | PSMA Aptamer (SZTI01) (ID# 8017) | Prostate-specific membrane antigen (PSMA) | GCGTTTTCGCTTTTGCGTTTTGGGTCATCTGCTTACGATAGCAATGCT | https://www.aptagen.com/apta-index/ | Protein | null | null | Unknown |
Mayer, Gunter, et al. “Fluorescence-activated cell sorting for aptamer SELEX with cell mixtures.” Nature Protocols 5, (2010): 1993-2004.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | C10 (ID# 8026) | CD19+ | CCCGGGTGTGGTGGGTGGGCAGGGGGGTTAGCATCTCACCAGCTCCGCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 49.6 nM |
Aptamer Binding Assay for the E Antigen of Hepatitis B Using Modified Aptamers with G-Quadruplex StructuresYanming Liu, Connie Le, D. Lorne Tyrrell, X. Chris Le, and Xing-Fang LiAnalytical Chemistry 2020 92 (9), 6495-6501DOI: 10.1021/acs.analchem.9b05740Miyakawa, Shin, et al. "Structural and molecular basis for hypersp... | DNA | EAg3-Py (ID# 8034) | Hepatitis B - E Antigen (HBeAg) | TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.4 nM |
Vianini et al. "In vitro selection of DNA aptamers that bind L-tyrosinamide." Bioorganic & Medicinal Chemistry, 9 (2001): 2543-2548.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | L-Tyrosinamide (pe35) (ID# 7519) | L-Tyrosinamide | AATTCGCTAGCTGGAGCTTGGATTGATGTGGTGTGTGAGTGCGGTGCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 45 µM |
Lauhon and Szostak. "RNA Aptamers That Bind Flavin and Nicotinamide Redox Cofactors." Journal of the American Chemical Society, 117(1994): 1246-1257.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | NAD (ID# 7552) | NAD | GGAACCCAACUAGGCGUUUGAGGGGAUUCGGCCACGGUAACAACCCCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 2.5 nM |
Lauhon and Szostak. "RNA Aptamers That Bind Flavin and Nicotinamide Redox Cofactors." Journal of the American Chemical Society, 117(1994): 1246-1257.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | NADH (ID# 7667) | NADH | GGAACCCAACUAGGCGUUUGAGGGGAUUCGGCCACGGUAACAACCCCUC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 37 nM |
Fu et al. "An ultrasensitive peroxidase DNAzyme-associated aptasensor that utilizes a target-triggered enzymatic signal amplification strategy." Chemical Communications, 47(2011): 9876-9878.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal... | DNA | DNA Blocker (Part of Lysozyme Aptasensor) (ID# 7703) | Lysozyme | ATCTACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACTTAGCCCGTGA | https://www.aptagen.com/apta-index/ | Other | null | null | Not Mentioned in Database |
YJ Lee et al. An RNA aptamer that binds carcinoembryonic antigen inhibits hepatic metastasis of colon cancer cells in mice. Gastroenterology 143(2012): 155-165.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | Chimeric | Carcinoembryonic Antigen Aptamer (YJ-1) (ID# 7712) | Carcinoembryonic Antigen (CEA) | GCGGAAGCGUGCUGGGCUAGAAUAAUAAUAAGAAAACCAGUACUUUCGU | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.77 nM |
Hicke, Brain, et al. "DNA Aptamers Block L-Selectin Function In Vivo Inhibition of Human Lymphocyte Traf?cking in SCID Mic." Journal of Clinical Investigation, 98 (1996): 2688-2692Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008)... | DNA | L-Selectin (LD201t1) (ID# 7772) | L-Selectin binding to sialyl Lewis X | TAGCCAAGGTAACCAGTACAAGGTGCTAAACGTAATGGCTTCGGCTTAC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Chang EK, Eckert MA, Ali MM, Riazifar H, Pone EJ, Liu L, et al. (2015) Facile Supermolecular Aptamer Inhibitors of L-Selectin. PLoS ONE 10(3): e0123034. doi:10.1371/journal.pone.0123034Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(... | DNA | L-Selectin Multivalent Aptamer (ID# 7951) | L-Selectin | TAGCCAAGGTAACCAGTACAAGGTGCTAAACGTAATGGCTTCGGCTTAC | https://www.aptagen.com/apta-index/ | Protein | null | null | Not Mentioned in Database |
Isolation and Identification of the DNA Aptamer Target to AcetamipridJiang He, Yuan Liu, Mingtao Fan, and Xianjin LiuJournal of Agricultural and Food Chemistry 2011 59 (5), 1582-1586DOI: 10.1021/jf104189gMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G... | DNA | Acetamiprid Binding Aptamer (S18) (ID# 8001) | Acetamiprid | TGTAATTTGTCTGCAGCGGTTCTTGATCGCTGACACCATATTATGAAGA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 4.98 µM |
Leva, S., et al. "GnRH Binding RNA and DNA Spiegelmers: A Novel Approach toward GnRH Antagonism." Chemistry and Biology, 9 (2002): 351-359.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | L-RNA | Gonadotropin-releasing hormone 1 (A10) (ID# 7492) | Gonadoliberin/Gonadotropin-releasing hormone 1 (GnRH) | CGGCCGAUAGAAAGACUACUUGAGCCCUUAAAUGAGGUUAUGUGCGGCCG | https://www.aptagen.com/apta-index/ | Peptide | null | null | 190 nM |
Cerchia, Laura, et al. "Neutralizing Aptamers from Whole-Cell SELEX Inhibit the RET Receptor Tyrosine Kinase." PLoS Biology, 3 (2004): e123Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Receptor Tyrosine Kinase (RET) Mutant (D4) (ID# 7500) | Receptor Tyrosine Kinase (RET) Mutant | GCGCGGGAAUAGUAUGGAAGGAUACGUAUACCGUGCAAUCCAGGGCAACG | https://www.aptagen.com/apta-index/ | Protein | null | null | 35 nM |
Burke et al. "RNA aptamers to the peptidyl transferase inhibitor chloramphenicol." Chemistry & Biology, 4(1997): 833-843.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Chloramphenicol (Cm1) (ID# 7556) | Chloramphenicol | GGGAUCACAGUGAAAAAAGACGUGUGAAUGUCACACUGAAAAAAGAUCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 110 nM |
Yu et al. "Aptamers can Discriminate Alkaline Proteins with High Specificity." Chem. Biochem. , 12(2011): 2659-2666.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Histone H4 N-terminal tail (4.33) (ID# 7721) | H4 N-terminal tail | TGGTGGGGTTCCCGGGAGGGCGGCTACGGGTTCCGTAATCAGATTTGTGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.3 nM |
Z Kiani et al. In vitro selection and characterization of deoxyribonucleic acid aptamers for digoxin. Analytica Chimica Acta 748(2012): 67-72.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Digoxin (Truncated D1) (ID# 7770) | Digoxin | AGCGAGGGCGGTGTCCAACAGCGGTTTTTTCACGAGGAGGTTGGCGGTGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.05 nM |
Li et al. "Characterization of DNA aptamers generated against the soft-shelled turtle iridovirus with antiviral effects." BMC Veterinary Research, 11 (2015): Article number 245.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1... | DNA | QA-36 (ID# 8089) | Soft-Shelled Turtle Iridovirus (STIV) | TGTGCGGGGGAGGGGAGTGGCGCTGTTGGTGCGGGTATAGCGCGTGGTGT | https://www.aptagen.com/apta-index/ | Other | null | null | 53.8 nM |
Dunn MR, McCloskey CM, Buckley P, Rhea K, Chaput JC. Generating Biologically Stable TNA Aptamers that Function with High Affinity and Thermal Stability. J Am Chem Soc. 2020 Apr 29;142(17):7721-7724. doi: 10.1021/jacs.0c00641. Epub 2020 Apr 20. PMID: 32298104.Miyakawa, Shin, et al. "Structural and molecular basis for hy... | DNA | HIV-RT 3.17 (ID# 8103) | HIV reverse transcriptase (HIV RT) | TTATGTAGCATTTATGAAATTTTTAAATCAATTTACTATTGGTGGTATCC | https://www.aptagen.com/apta-index/ | Cells | null | null | 0.38 nM |
Yu, F., Li, H., Sun, W., Xu, D. and He, F., 2019. Rapid selection of aptamers based on protein microarray. RSC advances, 9(17), pp.9762-9768.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | YFL-6 (ID# 8180) | Lactoferrin | AGGCAGGACACCGTAACCGGTGCATCTATGGCTACTAGCTCTTCCTGCCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 4.97 nM |
Pereira, A. C., Pina, A. F., Sousa, D., Ferreira, D., Santos-Pereira, C., Rodrigues, J. L., Melo, L. D. R., Sales, G., Sousa, S. F., & Rodrigues, L. R. (2022). Identification of novel aptamers targeting cathepsin B-overexpressing prostate cancer cells. Molecular Systems Design & Engineering, 7(6), 637–650. https://doi.... | DNA | Apt08rc (ID# 8207) | Cathepsin B | GGGCAGGCAACCTCCCACTATTGAAGACACTACCACCACCACTGCACACA | https://www.aptagen.com/apta-index/ | Protein | null | null | 10.1-10.7 nM |
Deniz Yılmaz, Tuğdem Muslu, Ayhan Parlar, Hasan Kurt, Meral Yüce,SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers, Journal of Biotechnology, Volume 354, 2022, Pages 10-20, ISSN 0168-1656.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human ... | DNA | EC1 (ID# 8208) | Escherichia Coli | AATGATGACATTCCGAGGTACCCAGAGTGCGATACTAACCGGCCTGCTTG | https://www.aptagen.com/apta-index/ | Cells | null | null | 1.165 nM |
Deniz Yılmaz, Tuğdem Muslu, Ayhan Parlar, Hasan Kurt, Meral Yüce, SELEX against whole-cell bacteria resulted in lipopolysaccharide binding aptamers, Journal of Biotechnology, Volume 354, 2022, Pages 10-20, ISSN 0168-1656.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human... | DNA | LM3 (ID# 8209) | Listeria monocytogenes | CCGTCCCGGTAGTCTGAGCTTACAATGTCTGATTGGAAATGCACACCAAG | https://www.aptagen.com/apta-index/ | Cells | null | null | 8.89 nM |
Heike, S., et al. "Aptamers that bind to the antibiotic moenomycin A." Bioorganic & Medicinal Chemistry, 9 (2001): 2557-2563.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-NH2-RNA | Moenomycin A (C2) (ID# 7494) | Moenomycin A | GGAGGUCGACCUCGCGCGAGGAGGGUGGAGGGUCGUAGAGCGCGUAGGAGG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 350 nM |
Bridonneau, P., et al. "High-Affinity Aptamers Selectively Inhibit Human Nonpancreatic Secretory Phospholipase A2 (hnps-PLA2)." Journal of Medicinal Chemistry, 41(1998): 778-786.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): ... | 2'-NH2-RNA | Human Nonpancreatic Secretory Phospholipase A2 (Aptamer 15) (ID# 7536) | Human Nonpancreatic Secretory Phospholipase A2 (hnps-PLA2) | GGGAAAAGAGACGGCCGGCGCCAUAGCCGAGAUCCGAGGUGUUGCCGAGAA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 1.7 nM |
Huang, Y. (2012). RNA aptamer-based functional ligands of the neurotrophin receptor, TrkB. J. Pharmacol. Exp. Ther. 82(2012):623-635.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Neurotrophin receptor, TrkB (C4-3) (ID# 7691) | Neurotrophin receptor, TrkB | GGGAGGACGAUGCGGUCGUAUUAUCCGCUGCACGCCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.1 nM |
Lee, Y., Kim, I., Park, S., Kim, Y., Wu, S., Lee, J., Noh, D., Kim, K., Ryu, S. and Suh, P. "Periostin-binding DNA aptamer inhibits breast cancer growth and metastasis." The American Society of Gene & Cell Therapy 21.5 (2013): 1004-13.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA ap... | RNA | Periostin Aptamer (PNDA-3) (ID# 7890) | Periostin | ACGAGTTGTCGCATGTGCGGTTCAGTCTGGTCCTTCAGCACCGTACAACAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.07 nM |
Veeramani, Suresh,et al."An RNA aptamer-based biomarker platform demonstrates high soluble CD25 occupancy by IL2 in the serum of follicular lymphoma patients" American Association for Cancer Research 7, (2019) 1511-1522Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human i... | RNA | Tr-8 (ID# 8036) | CD25 | GGGAGGACGAUGCGGGCCGUUGUUGUGUGCCGCCCCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 35.7 nM |
Veeramani, Suresh,et al."An RNA aptamer-based biomarker platform demonstrates high soluble CD25 occupancy by IL2 in the serum of follicular lymphoma patients" American Association for Cancer Research 7, (2019) 1511-1522Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human i... | RNA | Tr-1 (ID# 8037) | IL2-CD25 Complex | GGGAGGACGAUGCGGUCCUGUCGUCUGUUCGUCCCCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 67.8 nM |
Veeramani, Suresh,et al."An RNA aptamer-based biomarker platform demonstrates high soluble CD25 occupancy by IL2 in the serum of follicular lymphoma patients" American Association for Cancer Research 7, (2019) 1511-1522Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human i... | RNA | Tr-7 (ID# 8038) | IL2-CD25 Complex | GGGAGGACGAUGCGGUGAGUCGUUCCCUUCGUCCCCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 45.0 nM |
Yang KA, Barbu M, Halim M, et al. Recognition and sensing of low-epitope targets via ternary complexes with oligonucleotides and synthetic receptors. Nat Chem. 2014;6(11):1003-1008. doi:10.1038/nchem.2058Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G... | DNA | Fructose-bisboronic acid aptamer-sensor (ID# 8046) | Fructose | CTCTCGGGACGACGGCTGGCACGTTTGGTTCAAGAATGTGGGTGTCGTCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 4 nM |
Yang KA, Barbu M, Halim M, et al. Recognition and sensing of low-epitope targets via ternary complexes with oligonucleotides and synthetic receptors. Nat Chem. 2014;6(11):1003-1008. doi:10.1038/nchem.2058Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G... | DNA | Galactose-bisboronic acid aptamer-sensor (ID# 8047) | Galactose | CTCTCGGGACGACCACTACGCATAGTTTCTATCGCCAGGAAGGGTCGTCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 13 nM |
Yang KA, Barbu M, Halim M, et al. Recognition and sensing of low-epitope targets via ternary complexes with oligonucleotides and synthetic receptors. Nat Chem. 2014;6(11):1003-1008. doi:10.1038/nchem.2058Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G... | DNA | Phenylalanine-Cp*Rh(III) sensor (ID# 8048) | Phenylalanine | CTCTCGGGACGACGGACGCTAATCTTACAAGGGCGTAGTGTATGTCGTCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 3.2 nM |
Yang KA, Barbu M, Halim M, et al. Recognition and sensing of low-epitope targets via ternary complexes with oligonucleotides and synthetic receptors. Nat Chem. 2014;6(11):1003-1008. doi:10.1038/nchem.2058Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G... | DNA | Tryptophan-Cp*Rh(III) sensor (ID# 8050) | Tryptophan | CTCTCGGGACGACCGCGGTAGTCTTAACCTAAAGCGGTGTCAGGTCGTCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 1.2 µM |
Periera, A., Pina, A., Sousa, D., Ferriera, D., Periera, C., Rodrigues, J., Melo, L., Sales, G., Sousa, S., & Rodrigues, L. (2022). Identification of Novel Aptamers Targeting Cathepsin B-Overexpressing Prostate Cancer Cells, 1–14. https://doi.org/10.1039/d2me00022aMiyakawa, Shin, et al. "Structural and molecular basis ... | DNA | Apt01 (ID# 8200) | CatB | TGGGGGGCAAGCAATTGGTGTGTGGTGTAGCATCCCCCTGTACCGCGCGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 9.0 nM |
Song, Yanling; Song, Jia; Wei, Xinyu; Huang, Mengjiao; Sun, Miao; Zhu, Lin; et al. (2020): Discovery of Aptamers Targeting Receptor-Binding Domain of the SARS-CoV-2 Spike Glycoprotein. ChemRxiv. Preprint. https://doi.org/10.26434/chemrxiv.12053535.v2Song, Y., Song, J., Wei, X., Huang, M., Sun, M., Zhu, L., Lin, B., She... | DNA | SARS-CoV-2 Aptamer 1C (ID# 8006) | RBD of the Spike glycoprotein from SARS-CoV-2 | CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGCGTTAATGGACA | https://www.aptagen.com/apta-index/ | Protein | null | null | 5.8 nM |
Sylvestre, M.; Saxby, C.; Kacherovsky, N.; Gustafson, H.; Salipante, S.; Pun, S. Identification of a DNA Aptamer That Binds to Human Monocytes and Macrophages. Bioconjug. Chem. 2020 Aug 9; 31(8): 1899-1907. DOI: 10.1021/acs.bioconjchem.0c00247.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity ... | DNA | A2 (ID# 8125) | M0-like and M2-like macrophages and monocytes | GAAGAGTAGATGAAACGTTTTTTCGCCCGATAAAAGGGACGTGCGTCAGACA | https://www.aptagen.com/apta-index/ | Cells | null | null | 20-45 nM |
Hadi Bakhtiari, Abbas Ali Palizban, Hossein Khanahmad, and Mohammad Reza MofidACS Omega 2021 6 (16), 11005-11014DOI: 10.1021/acsomega.1c00876Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | #AP-Cell 1 (ID# 8146) | Aspartate β-Hydroxylase (ASPH) | CGGGACAAGACAACGAACGAACAGGAAGAGAACCGGAATGCAGACGTCAGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 47.51 ± 5.86 nM |
Hadi Bakhtiari, Abbas Ali Palizban, Hossein Khanahmad, and Mohammad Reza MofidACS Omega 2021 6 (16), 11005-11014DOI: 10.1021/acsomega.1c00876Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | #AP-Cell 3 (ID# 8147) | Aspartate β-Hydroxylase (ASPH) | CCGTATCGCCCAGGCAACTGGGCTAAACTTCCCAGAGGGAACGAAACCTGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 65.23 ± 9.61 nM |
Liu, M.; Wang, Z.; Tan, T.; Chen, Z.; Mou, X.; Yu, X.; Deng, Y.; Lu, G.; He, N. An Aptamer-Based Probe for Molecular Subtyping of Breast Cancer. Theranostics. 2018, 8, 5772-5783.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): ... | DNA | sk6Ea (ID# 7998) | SK-BR-3 cells (HER2 positive) | TCACGCCCGATAAGGGCGATGCCGATCCCTGTGGCCGTAGGGCAGTCCCCTAG | https://www.aptagen.com/apta-index/ | Cells | null | null | 34.79\u202c-63.85 nM |
Lin, N.; Wu, L.; Xu, X.; Wu, Q.; Wang, Y.; Shen, H.; Song, Y.; Wang, H., Zhu, Z.; Kang, D.; Yang, C. Aptamer Generated by Cell-SELEX for Specific Targeting of Human Glioma Cells. ACS Appl. Mater. Interfaces. 2021 Mar 3; 13(8): 9306-9315. DOI: 10.1021/acsami.0c11878.Miyakawa, Shin, et al. "Structural and molecular basis... | DNA | S6-1b (ID# 8136) | Membrane protein of glioma cell line SHG44 | CACAGGTTCCAGGTAATACCTAAGGGTATGCTCTCGCCTATTATATGGAGCAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.1-44 nM |
Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides. Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Phorate (SS4-54) (ID# 7681) | Phorate | AAGCTTTTTTGACTGACTGCAGCGATTCTTGATCGCCACGGTCTGGAAAAAGAG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 1.43 µM |
Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides. Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Profenofos (SS4-54) (ID# 7682) | Profenofos | AAGCTTTTTTGACTGACTGCAGCGATTCTTGATCGCCACGGTCTGGAAAAAGAG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 1.25 µM |
Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides. Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Isocarbophos (SS4-54) (ID# 7683) | Isocarbophos | AAGCTTTTTTGACTGACTGCAGCGATTCTTGATCGCCACGGTCTGGAAAAAGAG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 0.9 µM |
Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides. Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Omethoate (SS4-54) (ID# 7684) | Omethoate | AAGCTTTTTTGACTGACTGCAGCGATTCTTGATCGCCACGGTCTGGAAAAAGAG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 2 µM |
Congsheng Cheng, Yong Hong Chen, Kim A Lennox, Mark A Behlke, Beverly L Davidson, "In vivo SELEX for Identification of Brain-penetrating Aptamers" Molecular Therapy-Nucleic Acids (2013)2, e67, American Society of Gene & Cell TherapyMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptam... | RNA | A15 (ID# 7919) | Penetrating the Blood Brain Barrier (BBB) | GGGAGGACGAUGCGGCGUAUUGCGCGAGGAUUAUCCGCUCAUCGUUGUUGUUGUGCAGACGACUCGCCCGA | https://www.aptagen.com/apta-index/ | Other | null | null | . nM |
Sai Jin Xiao, Jun Zuo, Zhi Qiang Zhu, Yong Zhong Ouyang, Xing Lei Zhang, Huan Wen Chen, & Li Zhang (2015) Highly Sensitive DNAzyme Sensor for Selective Detection of Trace Uranium in Ore and Natural Water Samples. Sensors and Actuators B 210 (2015) 656-660Miyakawa, Shin, et al. "Structural and molecular basis for hypers... | DNA | Uranium DNAzyme (ID# 7950) | Uranium | CACGTCCATCTCTGCAGTCGGGTAGTTAAACCGACCTTCAGACATAGTAAGGGG | https://www.aptagen.com/apta-index/ | Other | null | null | n/a nM |
"In vitro HER2 protein-induced affinity dissociation of carbon nanotube-wrapped anti-HER2 aptamers for HER2 protein detection" J. H. Niazi, S. K. Verma, S. Niazi and A. Qureshi, Analyst, 2014DOI: https://doi.org/10.1039/C4AN01665CMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer... | DNA | H2 (ID# 8226) | HER-2 | GGGCCGTCGAACACGAGCATGGTGCGTGGACCTAGGATGACCTGAGTACTGTCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 270 nM |
Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides. Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Phorate (SS2-55) (ID# 7677) | Phorate | AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 1.11 µM |
Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides. Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Profenofos (SS2-55) (ID# 7678) | Profenofos | AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 1 µM |
Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides. Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Isocarbophos (SS2-55) (ID# 7679) | Isocarbophos | AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 0.83 µM |
Wang, L, et al. (2012). Selection of DNA aptamers that bind four organophosphorus pesticides. Biotechnol Lett, 2012(34), 869-874. doi: 10.1007/s10529-012-0850-6Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Omethoate (SS2-55) (ID# 7680) | Omethoate | AAGCTTGCTTTATAGCCTGCAGCGATTCTTGATCGGAAAAGGCTGAGAGCTACGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 2.5 µM |
K. P. Williams, D. P. Bartel, et al. Bioactive and nuclease-resistant l-DNA ligand of vasopressin. Proc. Natl. Acad. Sci., USA. 94(1997): 11285-11290.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | L-DNA | L-vasopressin (ID# 7820) | L-vasopressin/arginine vasopressin/AVP/ADH | TCACGTGCATGATAGACGGCGAAGCCGTCGAGTTGCTGTGTGCCGATGCACGTGA | https://www.aptagen.com/apta-index/ | Peptide | null | null | 1.2 µM |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.