image imagewidth (px) 258 933 | latex stringlengths 198 5.27k | filename stringlengths 18 19 |
|---|---|---|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{MIGS ID} & \textbf{Property} & \textbf{Term} \\
\hline
MIGS-31 & Finishing quality & finished \\
\hline
MIGS-28 & Libraries used & Three 454 PE genomic library (10.5 libraries: kb insert one 454 size), pyrosequence one Illumina standard library libr... | PMC3156407_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& & \multicolumn{3}{|l|}{\textbf{Anxiety}} & \multicolumn{3}{|l|}{\textbf{Depression}} \\
\hline
& & \textbf{ADL} & \textbf{Cognitive impairment} & \textbf{Behavioural problems} & \textbf{ADL} & \textbf{Cognitive impairment} & \textbf{Behaviou... | PMC6128659_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{|l|}{\textbf{Public School}} & \multicolumn{3}{|l|}{\textbf{Private School}} \\
\hline
& \textbf{Adjusted PRa} & \textbf{95\%CI} & \textbf{pb} & \textbf{Adjusted PRa} & \textbf{95\%CI} & \textbf{pb} \\
\hline
\multicolumn{7}{|l|}... | PMC5117583_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Complications} & \textbf{Beijing} & \textbf{NY} \\
\hline
Hydrocephalus & 7 (0.4 \%) & 0 (0.0 \%) \\
\hline
Meningitis & 3 (0.2 \%) & 0 (0.0 \%) \\
\hline
Permanent bulbar palsy & 4 (0.3 \%) & 0 (0.0 \%) \\
\hline
Cerebellar infarction & 3 (0.2 \%) ... | PMC4980444_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Characteristics} & \textbf{No. patients of moderately (\%) n = 342 ill} & \textbf{No. patients n = 188 of severe (\%)} & \multicolumn{2}{|l|}{\textbf{Univariate*}} & \multicolumn{2}{|l|}{\textbf{Multivariate{}} \\
\hline
& & & \textbf{OR ... | PMC3564919_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Group} & \multicolumn{2}{|l|}{\textbf{Week 1 a}} & \multicolumn{2}{|l|}{\textbf{Week 12}} & \textbf{P-value within group b} & \textbf{P-value between groups c} \\
\hline
& & \textbf{Mean} & \textbf{SEM} & \textbf{Mean} & \textbf{SEM} ... | PMC3150311_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{x} & \textbf{y} & \textbf{z} & \textbf{Uiso*/Ueq} \\
\hline
S & 0.07308 (7) & 0.15388 (7) & 0.18224 (8) & 0.0444 (3) \\
\hline
O & 0.3343 (2) & −0.0997 (2) & −0.2453 (3) & 0.0751 (8) \\
\hline
N1 & 0.0991 (2) & −0.0816 (2) & 0.2420 (3) & 0.04... | PMC2977727_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{n} & \textbf{Min} & \textbf{Max} & \textbf{Mean} & \textbf{Std Dev.} \\
\hline
Behavior & 89 & 2.83 & 4.34 & 3.86 & 0.53 \\
\hline
Change & 89 & 4.13 & 4.47 & 4.26 & 0.54 \\
\hline
PU/PEU & 89 & 4.02 & 4.46 & 4.26 & 0.51 \\
\hline
\end{tabu... | PMC3423046_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
Bruker SMART CCD area-detector diffractometer & 2983 independent reflections \\
\hline
Radiation source: fine-focus sealed tube & 1404 reflections with I $>$ 2$\sigma$(I) \\
\hline
graphite & Rint = 0.070 \\
\hline
$\phi$ and $\omega$ scans & $\theta$max = 27... | PMC3213638_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{4}{|l|}{\textbf{Odds ratio (95\% confidence interval) \& p-valuea}} \\
\hline
& \multicolumn{2}{|l|}{\textbf{Non-weighted risk score}} & \multicolumn{2}{|l|}{\textbf{Weighted risk score}} \\
\hline
& \textbf{unadjusted} & \textbf{adjus... | PMC4938564_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Young's modulus (N/mm)} & \textbf{Poisson's ratio} \\
\hline
Cancellous bone & 1370 & 0.30 \\
\hline
Cortical bone of & 13700 & 0.26 \\
\hline
PDL & 0.6668 & 0.49 \\
\hline
Tooth the & 20000 & 0.30 \\
\hline
Bracket and SS wire & 214000 & 0.30 \\... | PMC4884016_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Variable} & \textbf{n(\%)*} \\
\hline
Age & 21.04 (1.96) \\
\hline
\multicolumn{2}{|l|}{Gender} \\
\hline
Male & 215 (40.41\%) \\
\hline
Female & 317 (59.59\%) \\
\hline
\multicolumn{2}{|l|}{Institution} \\
\hline
Allama Iqbal Medical College & 178 (3... | PMC3119193_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
F2 Refinement on & Secondary atom site location: difference Fourier map \\
\hline
Least-squares matrix: full & Hydrogen site location: inferred from neighbouring sites \\
\hline
R[F2 2$\sigma$(F2)] $>$ = 0.073 & H-atom parameters constrained \\
\hline
wR(F2) ... | PMC3212259_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Response} & \textbf{Equation (variables are ordered by partial R2)} & \textbf{R2} & \textbf{Adjusted R2} & \textbf{LOOCVa R2} & \textbf{Highest Inflation (variable) Variance Factor} & \textbf{p-value} & \textbf{RMSEb} & \textbf{Responsec... | PMC5020732_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{matK} & \textbf{E. arvense unique substitutions} & \textbf{none} \\
\hline
& E. Equisetum arvense substitutions species but not shared with with E. palustre other & With With With With 397 572 294 E. E. sylvaticum: hyemale, G, A, E. A, E. E. E. flu... | PMC4499799_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Treatments} & \textbf{Sequence number*} & \textbf{OTUs} & \multicolumn{2}{|l|}{\textbf{Estimated OTU richness}} & \textbf{Shannon} \\
\hline
& & & \textbf{CHAO1} & \textbf{ACE} \\
\hline
CE1 & 1306 & 595 & 1422(1216;1698) & 2433(2197;2704) ... | PMC3606482_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{|l|}{\textbf{Men}} & \multicolumn{3}{|l|}{\textbf{Women}} \\
\hline
& \textbf{Newly n \% = (95\% 1 073 sick C.I) listed} & \textbf{General n \% = (95\% 1 730 population C.I)} & \textbf{Difference \% (95\% C.I.)} & \textbf{Newly n... | PMC3626677_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Cases/total} & \textbf{OR (95\%CI)} \\
\hline
0 MLE & 23/725 & Reference \\
\hline
Only child MLE & 15/332 & 1.55(0.79,3.03) \\
\hline
Only adult MLE & 69/1,581 & 1.60(0.98,2.60) \\
\hline
Child \& Adult MLE & 91/2,123 & 1.67(1.04,2.68) \\
\hline... | PMC4578856_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{ID No.} & \textbf{FitValue} & \textbf{Estimate} & \textbf{HBA_1} & \textbf{HBA_2} & \textbf{HY_3} & \textbf{RA_4} \\
\hline
F0325-0146 & 6.580 & 4.599 & 1 & 1 & 1 & 1 \\
\hline
F0289-0199 & 6.446 & 6.266 & 1 & 1 & 1 & 1 \\
\hline
F0922-0370 ... | PMC4682379_table_10 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Carcinogenesis Model} & \textbf{Carcinogen} & \textbf{Eugenol Administration} & \textbf{Effect} & \textbf{References} \\
\hline
Skin carcinogenesis & DMBA + TPA & Topical & Reduction in tumor incidence and size; and/or development of papillomato... | PMC5748817_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Nephrotic with hematuria range proteinuria}} & \textbf{P} & \multicolumn{2}{|l|}{\textbf{Nephrotic without hematuria range proteinuria}} & \textbf{P} & \multicolumn{2}{|l|}{\textbf{Nephrotic with or without rang... | PMC5123353_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Antibody} & \textbf{Median value of titer in AS patients} & \textbf{Median value of titer in control patients} & \textbf{value P} \\
\hline
IgA ASCA & 1.24 & 1.10 & 0.28 \\
\hline
IgG ASCA & 4.70 & 4.05 & 0.29 \\
\hline
Anti-I2 & 11.78 & 7.86 & 0.... | PMC3003540_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
D—H···A & D—H & H···A & D···A & D—H···A \\
\hline
O35—H35···O27 & 0.82 & 1.99 & 2.784 (3) & 163 \\
\hline
C9—H9···O35i & 0.93 & 2.46 & 3.320 (4) & 153 \\
\hline
C19—H19···O11ii & 0.93 & 2.60 & 3.403 (3) & 144 \\
\hline
\end{tabular}}
\end{table} | PMC3011768_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{|l|}{\textbf{Wukro Town (n = 103)}} & \multicolumn{3}{|l|}{\textbf{Kilteawlaelo (n = 195)}} \\
\hline
\textbf{Variables} & \textbf{Agree n (\%)} & \textbf{Neutral n (\%)} & \textbf{Disagree n (\%)} & \textbf{Agree n (\%)} & \textb... | PMC4560916_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{No} & \textbf{AREA} & \textbf{Total Amount of Events} & \textbf{Max. Magnitude} & \textbf{Median Magnitude} & \textbf{Number of Mainshocks} \\
\hline
1 & Aragonese & 1775 & 6.2 & 4.2 & 208 \\
\hline
2 & Cyprus & 1412 & 6.1 & 4.3 & 376 \\
\hlin... | PMC4790910_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Protein or gene} & \textbf{Ac} & \textbf{Ad} & \textbf{Na} & \textbf{Hc} & \textbf{Ans} & \textbf{Ass} & \textbf{Tc} & \textbf{Bm} & \textbf{Di} & \textbf{Ov} \\
\hline
ATP6 & 85.9 & 85.4 & 86.9 & 78.8 & 73.3 & 74.3 & 74.8 & 19.8 & 2... | PMC2656527_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Covariate} & \multicolumn{2}{|l|}{\textbf{All‑ cause mortality}} & \multicolumn{2}{|l|}{\textbf{Malaria specific mortality}} \\
\hline
& \textbf{Post‑neonates HR (95\% CI)} & \textbf{Child HR (95\% (1–4 CI) year} & \textbf{Post‑neonates HR (95\... | PMC5774157_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Mean Amplitude (mV) (300–800 ms)}} & \multicolumn{2}{|l|}{\textbf{Peak Amplitude (mV) (jackknifed values)}} & \multicolumn{2}{|l|}{\textbf{Peak Latency (ms) (jackknifed values)}} \\
\hline
\textbf{Condition} & \textbf... | PMC2777337_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Adverse event during treatment} & \textbf{Number episodes of} \\
\hline
Nasal Discomfort/Pain due to catheter & 3 \\
\hline
Nasal discomfort due to cooling & 2 \\
\hline
Hypertension & 2 \\
\hline
Mild epistaxis & 1 \\
\hline
Discomfort due to excess ... | PMC4405521_table_5 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Species} & \textbf{Host(s)} \\
\hline
Phytophthora capsici & Curcubits (e.g., Cucurbita pepo) \\
\hline
Phytophthora infestans & Solanaceae (e.g., Solanum tuberosum) \\
\hline
Phytophthora kernoviae & Fagus sylvatica, Rhododendron \\
\hline
Phytophtho... | PMC5023847_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Infected patients} & \textbf{Control patients} \\
\hline
Number of patients & 30 & 5 \\
\hline
Age (years)a & 58.6 (23–86) & 52.6 (21–71) \\
\hline
Gender (male/female) & 10/20 & 3/2 \\
\hline
\multicolumn{3}{|l|}{Infection types} \\
\hline
Bacte... | PMC5904094_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Category} & \textbf{No. of Articles} & \textbf{\%} \\
\hline
\multicolumn{3}{|l|}{Journal Type} \\
\hline
General & 45 & 48\% \\
\hline
Human & 40 & 43\% \\
\hline
Animal & 7 & 8\% \\
\hline
Plants & 1 & 1\% \\
\hline
\multicolumn{3}{|l|}{Sector} \\... | PMC3413711_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Mean age (years)} & \textbf{N} & \textbf{Type} & \textbf{C/C} & \textbf{C/G} & \textbf{G/G} & \textbf{Padd} & \textbf{Pdom} & \textbf{Prec} \\
\hline
7.6 & 6,013 & Systolic & 98.578 (8.550) & 98.644 (9.058) & 98.932 (9.259) & 0.275 & 0.7... | PMC4388908_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Breast characteristics Clinicopathological} & \textbf{Cancer} & \textbf{Fibroadenoma} & \textbf{Normal} \\
\hline
Number of patients & 103 & 35 & 30 \\
\hline
Median Patient Age yrs & 56 (35–90) & 44 (17–62) & 46.5 (24–58) \\
\hline
\multicolumn{4... | PMC4425901_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{Reference} & \textbf{Ph} & \textbf{Masking} & \textbf{Histology} & \textbf{No.} & \textbf{Treatment arms} \\
\hline
\multicolumn{7}{|l|}{Nivolumab} \\
\hline
1 & Brahmer J. et al. (2015) & 3 & Open-label & NSCLC (Sq) & 272 & Nivolumab \\
... | PMC5823578_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& & & & \multicolumn{4}{|l|}{\textbf{SIRS criteria}} \\
\hline
\textbf{Dog} & \textbf{Age} & \textbf{Breed} & \textbf{Presenting Signs} & \textbf{HR (per min)} & \textbf{RR (per minute)} & \textbf{Body temperature (°C)} & \textbf{WBC ($\time... | PMC6020318_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Temporal resolution} & \textbf{NTrans} & \textbf{200($\mu$s)/NTrans} & \textbf{NCS} \\
\hline
T0 & 0$<$ NTrans $<$ = 10 & 20$\mu$s to 200$\mu$s & 10 \\
\hline
T1 & NTrans 10$<$ $<$ = 100 & 2$\mu$s 20$\mu$s to & 35 \\
\hline
T2 & 100$<$ NTrans = 10... | PMC4461368_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Class} & \textbf{Subclass} & \textbf{Number gene families of} & \textbf{Number of genes} & \textbf{Number pseudogenes of} \\
\hline
ANTP & HOXL & 14 & 52 & 0 \\
\hline
& NKL & 23 & 48 & 19b \\
\hline
PRD & PAX & 3 & 7a & 0 \\
\hline
& PAXL & 2... | PMC2211742_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Variables} & \textbf{B} & \textbf{b} & \textbf{t-statistic} & \textbf{p-value} \\
\hline
Age & −0.113 & −0.021 & −1.80 & .0731 \\
\hline
Education & −0.218 & −0.095 & −3.02 & .0028 \\
\hline
Income & −0.063 & −0.038 & −0.73 & .4679 \\
\hline
Mar... | PMC5663150_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{MacoNPV- B} & \multicolumn{5}{|l|}{\textbf{Homologoues (\% aa identity)}} \\
\hline
& \textbf{ORF54} & \textbf{ORF55} & \textbf{ORF56} & \textbf{ORF57} & \textbf{ORF58} \\
\hline
XecnGV & ORF65(98) & ORF64(98) & ORF62(93) & ORF61(98) & ORF131... | PMC3545888_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& \textbf{OMIM} & \textbf{GAD} & \textbf{MSigDB} & \textbf{GeneSigDB} & \textbf{miRecords} & \textbf{HPD} & \textbf{HAPPI*} \\
\hline
OMIM & 9012 & 1862 & 3489 & 2792 & 231 & 2559 & 3849 \\
\hline
GAD & & 7293 & 6821 & 6450 & 432 & 3202 & 4922 \... | PMC3439733_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{8}{|l|}{\textbf{S. Typhimurium (\% of total S. Typhimurium, n = 114)}} & \multicolumn{4}{|l|}{\textbf{S. Enteritidis (\% n of = total 78) S. Enteritidis,}} & \textbf{Total of total (\% NTS)} \\
\hline
& \textbf{blood} ... | PMC4352093_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& & \multicolumn{4}{|l|}{\textbf{P. falciparum}} & \multicolumn{4}{|l|}{\textbf{P. vivax}} \\
\hline
& & \textbf{GMD} & \textbf{$\beta$} & \textbf{95\% CI} & \textbf{P-value} & \textbf{GMD} & \textbf{$\beta$} & \textbf{95\% CI} & \textbf{P... | PMC4440770_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& & \multicolumn{3}{|l|}{\textbf{Men}} & \multicolumn{3}{|l|}{\textbf{Women}} \\
\hline
& & \textbf{Control n = 99} & \textbf{Exposed n = 115} & \textbf{P- value} & \textbf{Control n = 80} & \textbf{Exposed n = 108} & \textbf{P-value} \\
\hlin... | PMC3549740_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Edge} & \textbf{Weight} & \textbf{Reference for weight} \\
\hline
CDR & 1.0 & Ratio of CDR:FR mutations \\
\hline
FR & 0.79 \\
\hline
CDR - exposed & 0.78 & Ratio of buried:exposed CDR mutations \\
\hline
CDR - buried & 1.0 \\
\hline
FR - exposed & ... | PMC3098112_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\multicolumn{2}{|l|}{\textbf{HBeAg-positive CHB patients}} \\
\hline
\textbf{Factors} & \textbf{points} \\
\hline
\multicolumn{2}{|l|}{Model A} \\
\hline
HBsAg $<$ 250 IU/mL & 1 \\
\hline
HBV DNA $<$ 2.5 $\times$ 107 IU/mL & 1 \\
\hline
\multicolumn{2}{|l|}{M... | PMC4941731_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& & \textbf{N} & \textbf{Ne} & \textbf{H} & \textbf{He} \\
\hline
MCL1 & real time RT-PCR & 1 & 2.97 & 5.53 & 8.24 \\
\hline
& DNA microarray & 1 & 3.44 & 3.92 & 5.27 \\
\hline
BAK 1 & real time RT-PCR & 1 & 3.37 & 0.96 & 2.92 \\
\hline
& DNA micr... | PMC2330149_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Cases} & \textbf{Pearson (x-axis) r} & \textbf{Pearson (y-axis) r} & \textbf{tracking automatic ROM axis) in (x-} & \textbf{tracking manual ROM (x-axis) in} & \textbf{errors Relative (x-axis) \%} & \textbf{tracking automatic ROM ax... | PMC5705154_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Adverse events} & \textbf{Paccagnella al. 201018 et} & \textbf{201119 Chen et al.} & \textbf{Haddad 201320 et al.} & \textbf{Cohen 201421 et al.} & \textbf{201422 et Hitt al.} & \textbf{Incidence (\%)} \\
\hline
\multicolumn{7}{|l|}{Haematol... | PMC4455182_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Patient characteristics} & \multicolumn{3}{|l|}{\textbf{Group}} & \textbf{P-value} \\
\hline
& \textbf{Faculty physician (\%)} & \textbf{General doctor (\%)} & \textbf{Resident (\%)} \\
\hline
Mean age (SD), years & 50.39 (15.65) & 49.32 (15.86... | PMC1852109_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
C13H12N2OS & F(000) = 512 \\
\hline
Mr = 244.31 & m−3 Dx = 1.340 Mg \\
\hline
Monoclinic, P21/c & Mo K$\alpha$ radiation, $\lambda$ = 0.71073 Å \\
\hline
Hall symbol: -P 2ybc & Cell parameters from 1759 reflections \\
\hline
a = 14.920 (3) Å & $\theta$ = 27.5... | PMC2979519_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Classification} & \multicolumn{6}{|l|}{\textbf{Percentage Treatment2 of total sequences1}} & \textbf{Effect} & \textbf{SEM} & \textbf{P-value4} \\
\hline
\\
\hline
& \multicolumn{2}{|l|}{\textbf{Control}} & \multicolumn{2}{|l|}{\text... | PMC6193618_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& & \textbf{Frequency, person} & \textbf{Proportion, \%} & \textbf{Age, years old (SD)} \\
\hline
Gender & Male & 49 & 40.8 & 61 (10.9) \\
\hline
& Female & 71 & 59.2 & 62 (12.1) \\
\hline
Facility & Field & 56 & 46.7 & 65 (10.7) \\
\hline
& PVC gre... | PMC4640324_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Vegetation} & \textbf{Camera height (m)} & \multicolumn{2}{|l|}{\textbf{Time-lapse camera}} & \multicolumn{2}{|l|}{\textbf{Motion-activated camera}} \\
\hline
& & \textbf{Total no. imagesa} & \textbf{No. sheep visits} & \textbf{No. sheep vis... | PMC4623860_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
Center for Computational Research at SUNY Buffalo & http://www.ccr.buffalo.edu/display/WEB/Outreach \\
\hline
Cold Spring Harbor Laboratory Dolan Learning Center & http://www.dnalc.org/programs/fieldtrips/hsbioinform.html \\
\hline
CusMiBio, University of Mil... | PMC3203059_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{CuO} & \textbf{TiO2} \\
\hline
Shape & spheroid & spheroid \\
\hline
size of primary particles (TEM) & 22$\pm$5 nm & 25$\pm$10 nm \\
\hline
& 70$\pm$27 nm \\
\hline
zeta potential & +3.3 mV & -11.3 mV \\
\hline
XRD & conform & Anatase \\
\hline
... | PMC4406518_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{n 51 675} & \textbf{SF (n n (\%) = 14 234)} & \textbf{NP (n n (\%) = 20 371)} & \textbf{NVP (n n (\%) = 17 070)} & \textbf{P valuea} \\
\hline
\\
\hline
\\
\hline
Gestation length & 51 675 & & & & 0.001 \\
\hline
Normal range 37–42 wee... | PMC4477493_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{miRNAs} & \textbf{AUC (95 \% CI)} & \textbf{Sensitivity (95 \% CI)} & \textbf{Specificity (95 \% CI)} & \textbf{P value} \\
\hline
miR-31 & 0.76 (0.70 to 0.83) & 61.66 (55.35 to 67.68) & 81.86 (76.23 to 86.83) & $<$0.001 \\
\hline
miR-21 & 0.80 ... | PMC5070138_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Study} & \textbf{Outcome} & \textbf{Parameter interval estimate and 95\% confidence} \\
\hline
\multicolumn{3}{|l|}{Mortality 2° to COPD} \\
\hline
Ishida W, et al., Japan, 2007 [23] & Decreased mortality 2° to COPD in statin users & Inverse dispens... | PMC2716302_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Attack ID} & \textbf{Attack} & \textbf{Parameters} \\
\hline
FLIP & Flip & Horizontal flip \\
\hline
DQ1 & Frame change rate & 20 fps \\
\hline
& Contrast change & +10\% \\
\hline
& Noise Addition & Gaussian: mean = 0; variance = 0.01 \\
\hline
DQ... | PMC5115698_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\multicolumn{2}{|l|}{\textbf{Polymorphisms}} & \multicolumn{2}{|l|}{\textbf{French}} & \multicolumn{2}{|l|}{\textbf{German}} \\
\hline
\textbf{rs1878326} & \textbf{rs4945} & \textbf{FCTL (n = 238)} & \textbf{FAMD (n = 269)} & \textbf{GCTL (n = 253)} &... | PMC3305292_table_4 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& & \multicolumn{6}{|l|}{\textbf{HELIOS indicator set}} & \textbf{3 PSI M} & \textbf{Mort SP} & \textbf{LOS SP} \\
\hline
& & \textbf{HELIOS group 3 M} & \textbf{HELIOS target 3 M} & \textbf{InMed assessment HELIOS} & \textbf{InMed bench... | PMC3114706_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Scales} & \textbf{Variable in equation} & \textbf{Standardized Beta} & \textbf{R2} & \textbf{Sig.} & \textbf{Number of samples} \\
\hline
Zone1 & \multicolumn{4}{|l|}{no variables were entered} & 27 \\
\hline
Zone2 & \multicolumn{4}{|l|}{no va... | PMC3524620_table_4 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Primer name in a} & \textbf{Nucleotide sequence (5’ to 3’)} & \textbf{Ta (°C)} & \textbf{Expected size (bp)} \\
\hline
matK _F sys- & CTTCTTATTTACGATTAACATCTTCT & 57 & 160 \\
\hline
matK _R & TTTCCTTGATATCGAACATAATG \\
\hline
rbcL_F & GGTACATGGACA... | PMC4448308_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Anther size (mm)} & \textbf{$<$1} & \textbf{1–2} & \textbf{2–3} & \textbf{3–4} & \textbf{4–5} & \textbf{5–5.5} & \textbf{5.5–6.5} \\
\hline
Normal (n = 28) & 0 & 0 & 0 & 0 & 0 & 36\% & 64\% \\
\hline
fzt (n = 150) & 11\% & 49\% & 25\% & 15... | PMC4706427_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Soil properties} & \textbf{Shinille soil} \\
\hline
pH in H2O & 7.74 \\
\hline
EC (mS/cm) & 4.12 \\
\hline
Organic carbon (\%) & 2.15 \\
\hline
Total nitrogen (\%) & 0.29 \\
\hline
kg−1) Available P (mg & 25.85 \\
\hline
kg−1) Ca (cmol(+) & 31.10 \\
\... | PMC4447725_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Case} & \textbf{ETI Successful} & \textbf{Type of injury} & \textbf{NACA} & \textbf{CGS} & \textbf{RTS} & \textbf{Outcome} \\
\hline
Oesophageal intubation & Yes & Blunt & 6 & 3 & 3.51 & Dead $<$ 24 h \\
\hline
Bleeding & No & Blunt & 6 & 3 ... | PMC2903496_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Secondary diagnosis} & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & \textbf{6} & \textbf{7} \\
\hline
Atrial fibrillation (\%) & 17.16 & --- & 4.26 & --- & 5.95 & 3.85 & 6.02 \\
\hline
Anaemia (\%) & 1.49 & --- & 2.13 &... | PMC4384319_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Risk factor} & \textbf{Relative risk} \\
\hline
Lack of social engagement & 2.34 (1.18–4.65) \\
\hline
Depression & 1.90 (1.55–2.33) \\
\hline
Physical inactivity & 1.82 (1.19–2.45) \\
\hline
Hypertension (midlife) & 1.61 (1.16–2.24) \\
\hline
Obesity... | PMC5112261_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Category to} \\
\hline
Total number of reads pio- & 1,366,749 \\
\hline
Total length of reads (bp) as & 625,825,203 \\
\hline
Total number of reads cleaned been & 1,361,424 \\
\hline
Total length of reads cleaned (bp) and & 598,655,879 \\
\hline
Numbe... | PMC3019233_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{n} & \textbf{20th centile (days)} & \textbf{50th centile/ median (days)} & \textbf{80th centile (days)} & \multicolumn{3}{|l|}{\textbf{\% over 1 year}} & \multicolumn{3}{|l|}{\textbf{\% over 5 years}} \\
\hline
& & & & & \tex... | PMC4485346_table_6 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Patient 1} & \textbf{Patient 2} & \textbf{Patient 3} & \textbf{Patient 4} & \textbf{Patient 5} \\
\hline
Age & 55 & 50 & 67 & 72 & 72 \\
\hline
Gender & Male & Male & Male & Male & Male \\
\hline
Primary tumor & Sigmoid colon & Ascending co... | PMC3570337_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Domains} & \textbf{Pre-OP (n 12) =} & \textbf{Post-OP (n 12) =} & \textbf{P values} \\
\hline
Sexual desire & 3.2 0.8 $\pm$ & 3.4 0.3 $\pm$ & 0.31 \\
\hline
Sexual arousal & 3.9 0.6 $\pm$ & 4.0 0.9 $\pm$ & 0.34 \\
\hline
Lubrication & 5.7 2.1 $\pm... | PMC5861080_table_6 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \multicolumn{3}{|l|}{\textbf{Odds ratio Age (95\% at menarche, confidence years interval)a, b}} \\
\hline
\\
\hline
\textbf{Tumor characteristic} & \textbf{11} & \textbf{$>$ 11 and 13} & \textbf{$>$ 13 and 14} \\
\hline
\multicolumn{4}{|l|}{Tumor s... | PMC2656904_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Initial individuals) 3 months (n = 583} & & \textbf{After individuals) 3 months (n = 559} \\
\hline
Variable & Unadjusted CI) Hazard Ratio (95\% & Adjusted (95\% CI) Hazard Ratio & Unadjusted CI) Hazard Ratio (95\% & Adjusted (95\% CI) Hazar... | PMC2835706_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Features} & \textbf{AUC} & \multicolumn{2}{|l|}{\textbf{95\% Conf. Int.}} & \textbf{p-value} \\
\hline
\textbf{HHL Skewness} & \textbf{0.51} & \textbf{0.40} & \textbf{0.57} & \textbf{0.74} \\
\hline
HLH Median & 0.52 & 0.44 & 0.61 & 0.64 \\
\hli... | PMC5690632_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Clinical variant} & \textbf{Healthy dogs} & \textbf{Babesiosis positive dogs} \\
\hline
Rectal temperature (°F) & 102.00$\pm$00.21 & 102.96$\pm$00.23** \\
\hline
Heart rate (beats/min) & 117.00$\pm$03.04 & 129.88$\pm$02.94** \\
\hline
Respiration ra... | PMC5682268_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
F2 Refinement on & Secondary atom site location: difference Fourier map \\
\hline
Least-squares matrix: full & Hydrogen site location: inferred from neighbouring sites \\
\hline
R[F2 2$\sigma$(F2)] $>$ = 0.031 & H atoms treated by a mixture of independent and... | PMC2961304_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Study} & \textbf{Trial type} & \textbf{Random sample} & \textbf{Allocation concealment} & \textbf{Blinded allocation} & \textbf{Lost of follow-up} & \textbf{ITT} & \textbf{Grade} \\
\hline
Lo CM & RCT & Adequate & Adequate & Unclear & Yes ... | PMC4899889_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Treatments} & \multicolumn{3}{|l|}{\textbf{Proximal ileum}} & \multicolumn{3}{|l|}{\textbf{Distal ileum}} \\
\hline
& \textbf{Amylose, \%} & \textbf{Amylopectin, \%} & \textbf{Total starch, \%} & \textbf{Amylose, \%} & \textbf{Amylopectin, ... | PMC5846306_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Analyses} & \textbf{Dose Group} & \multicolumn{3}{|l|}{\textbf{Proportion of Responders}} & \multicolumn{2}{|l|}{\textbf{SBA Titers four weeks after vaccination}} \\
\hline
& & \textbf{n/N} & \textbf{\%} & \textbf{95\% CI} & \textbf{GMT} &... | PMC2584372_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Never N (\%)} & \textbf{Rarely N (\%)} & \textbf{Occasionally N (\%)} & \textbf{Pretty Often N (\%)} & \textbf{Very Often N (\%)} \\
\hline
To prepare for a [rheumatology/gastroenterology] visit & 44 (22.0) & 37 (18.5) & 73 (36.5) & 33 (16.... | PMC5024421_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Total a}} & \multicolumn{4}{|l|}{\textbf{Index eGFR (ml/min/1.73 m2)}} \\
\hline
& & & \textbf{$\geq$60 OR (95\% b CI)} & \textbf{P} & \textbf{30 OR ~ (95\% 59 c CI)} & \textbf{P} \\
\hline
& \textbf{OR (95\% CI)}... | PMC3411407_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Authors} & \textbf{Study group} & \textbf{Age} & \textbf{Study design} & \textbf{Tests used} & \textbf{Aerobic power} & \textbf{Strength power} & \textbf{Psychological findings hormonal} \\
\hline
Boone Gilmore, and 1995 & 11 male sedentar... | PMC4914923_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\multicolumn{2}{|l|}{Symptoms:} \\
\hline
• & Exposure (work)-related cough, chest tightness, dyspnea, fever, with latency period of several hrs \\
\hline
• & Progressive flu-like symptoms during the exposure periods (e.g. working week) with solution at days ... | PMC4408564_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{qPCR primer} & \textbf{Sequence} \\
\hline
RPS6 right & TGA TGT CCG CCA GTA TGT TG \\
\hline
RPS6 left & TCT TGG TAC GCT GCT TCT TC \\
\hline
TFAP2 right & ATT GAC CTA CAG TGC CCA GC \\
\hline
TFAP2 left & ATG CTT TGG AAA TTG ACG GA \\
\hline
PAX6 rig... | PMC6057744_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Aim} & \textbf{Question} \\
\hline
Attitude and practice underlying SAP behaviour & 1. What is your opinion about the surgical antibiotic prophylaxis in your hospital? 2. According to clinical guidelines, the use of third or fourth-generation cephalos... | PMC5139116_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Parameter} & \textbf{Value} & \textbf{Value (Natural Units)} \\
\hline
Frecuency (f) & - & 2.4 GHz \\
\hline
($\lambda$) Wave length & - & 0.125 m \\
\hline
Transmitted power (PT) & 3 dBm = −27 dB & 1.995 mW \\
\hline
Antenna gain (GT y GR) & 32.39 ... | PMC4701321_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{n} & \textbf{RRR (95\% CI)} & \textbf{P-value} \\
\hline
1. Other trauma/no PTSD & 365 & Reference \\
\hline
2. Other trauma/PTSD & 15 & 1.03 (0.99, 1.06) & 0.090 \\
\hline
3. Assaultive violence/no PTSD & 131 & 1.02 (1.01, 1.03) & 0.003 \\
\hl... | PMC3677906_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{4}{|l|}{\textbf{Spearman’s correlation coefficients (p value is two-tailed)}} \\
\hline
& \textbf{NoV I} & \textbf{NoV II} & \textbf{EoV} & \textbf{AdV} \\
\hline
TC & −0.503(0.196) & −0.353(0.260) & 0.359(0.452) & 0.052(0.921) \\
\hlin... | PMC5755429_table_5 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Functional type} & \textbf{Fluffy tails (F$>$2)} & \textbf{No fluffy tails (F$<$2)} & \textbf{Positive rate} & \textbf{Negative rate} \\
\hline
Regulatory regions & 51 & 9 & 85 \% & 15 \% \\
\hline
Exons & 1 & 59 & 1.6 \% & 98.4 \% \\
\hline
Non... | PMC1127108_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
Bruker SMART APEX CCD diffractometer & 3525 independent reflections \\
\hline
Radiation source: fine-focus sealed tube & 1981 reflections with I $>$ 2$\sigma$(I) \\
\hline
graphite & Rint = 0.046 \\
\hline
mm-1 Detector resolution: 0.3 pixels & $\theta$max = ... | PMC3201509_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Energy carrier} & \textbf{Process} & \textbf{Blue (m3/1012 water footprint J)} \\
\hline
Wind energy & Construction, the erection turbines and operation of & 0.0a \\
\hline
Coal & Surface mining & 2–5a \\
\hline
& Deep mining & 3–20a \\
\hline
& B... | PMC4648423_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Validated by mimMiner or not (Y/ a N)} & \textbf{Validated by combination or not (Y/N) a} & \textbf{913 genes of monogenic diseases} & \textbf{427 genes of 165 polygenic diseases} \\
\hline
N & N & 736 & 324 \\
\hline
Y & Y & 116 & 75 \\
\hline
Y ... | PMC4944959_table_6 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Type of non-RCT PAM} & \textbf{n} \\
\hline
Drug interaction and PK studies & 7 \\
\hline
Post-authorisation safety studies & 5 \\
\hline
Single-arm studies & 4 \\
\hline
Long-term observational or non-interventional studies & 3 \\
\hline
Registries &... | PMC5042914_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Flight style estimate} & \textbf{No phylogeny} & \textbf{Livezey \& Zusi [35]} & \textbf{Hackett et al. [34]} \\
\hline
Brachial index & F = 0.22, df = 1,58, p = 0.64 & F = 0.002, df = 1,57, p = 0.96 & F = 0.05, df = 1,57, p = 0.82 \\
\hline
Rayne... | PMC3692442_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Day} & \textbf{WT chimera} & \textbf{Rev-erb DKO chimera} \\
\hline
0 & 29 & 28 \\
\hline
1 & 28 & 27 \\
\hline
2 & 26 & 25 \\
\hline
3 & 17 & 17 \\
\hline
4 & 21 & 20 \\
\hline
5 & 22 & 20 \\
\hline
6 & 22 & 20 \\
\hline
7 & 13 & 12 \\
\hline
8 & 2... | PMC4963201_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{VLPs} & \multicolumn{10}{|l|}{\textbf{VHH GI.1 specific}} & \multicolumn{8}{|l|}{\textbf{VHH GII.4 specific}} \\
\hline
& \textbf{N1} & \textbf{N2} & \textbf{N3} & \textbf{N4} & \textbf{N5} & \textbf{N6} & \textbf{N7... | PMC4534396_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Gene Symbol} & \textbf{Gene Name} & \textbf{Biology Process} & \textbf{Fold Change} & \textbf{P value} \\
\hline
EGR4 & early growth response 4 & regulation of cell proliferation; positive regulation of transcription; positive regulation of macr... | PMC4537115_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Gleason score} & \textbf{N} & \textbf{High} & \textbf{Low} \\
\hline
6 & 20 & 5 & 15 \\
\hline
7 & 20 & 12 & 8 \\
\hline
8 & 30 & 27 & 3 \\
\hline
9 & 10 & 9 & 1 \\
\hline
10 & 10 & 10 & 0 \\
\hline
\end{tabular}}
\end{table} | PMC4880832_table_0 |
End of preview. Expand in Data Studio
README.md exists but content is empty.
- Downloads last month
- 3