image imagewidth (px) 258 933 | latex stringlengths 198 5.27k | filename stringlengths 18 19 |
|---|---|---|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Vaccine protein} & \textbf{Adjuvant} & \textbf{Log10 cfu/spleen} & \textbf{Unit of protection} & \textbf{P-valuea} \\
\hline
BMEI0357 & CFA/IFA & 4.83 0.25 $\pm$ & 1.2 & 0.0019 \\
\hline
BMEI1098 & CFA/IFA & 4.57 0.25 $\pm$ & 1.46 & 0.0009 \\
\h... | PMC4625564_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
D—H···A & D—H & H···A & D···A & D—H···A \\
\hline
N2—H2···O3i & 0.86 & 1.96 & 2.809 (2) & 167 \\
\hline
N3—H3B···O1ii & 0.86 & 2.14 & 2.958 (2) & 160 \\
\hline
N3—H3A···N1 & 0.86 & 2.35 & 2.697 (2) & 105 \\
\hline
\end{tabular}}
\end{table} | PMC3011812_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Formula} & & \textbf{Herbs} \\
\hline
SJYJJS & Mulberry leaf & Chrysanthemum & Forsythia suspense & Reed rhizome \\
\hline
& Common hogfennel root & Bitter apricot kernel & Platycodon root & Liquorice \\
\hline
SKT & Mulberry leaf & Fermented ... | PMC3594946_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& & \multicolumn{4}{|l|}{\textbf{Gender}} \\
\hline
& & \multicolumn{2}{|l|}{\textbf{Male}} & \multicolumn{2}{|l|}{\textbf{Female}} \\
\hline
& & \textbf{N} & \textbf{\%} & \textbf{N} & \textbf{\%} \\
\hline
Age Group & $<$ 25 & 98 & 29.5 & 59 &... | PMC5755402_table_4 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Phage name} & \textbf{GenBank accession no.} & \textbf{Isolation source} & \textbf{Location} & \textbf{Genome length (bp)} & \textbf{GC content (\%)} \\
\hline
BN12 & MG727695 & Bee debris & Cedar City, Utah, USA & 39,485 & 42.6 \\
\hline
Drag... | PMC6003738_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Compd} & \textbf{R1} & \textbf{R2} & \textbf{R3} & \textbf{TryR [mm] IC50} \\
\hline
39 & Me & Me & 4’-Methylphenyl & 8.6 \\
\hline
40 & Me & CH2CH3 & Thiophen-2-yl & 12.8 \\
\hline
41 & Me & CH2CH3 & 2’-Fluoro-5’-Bromophenyl & 10.2 \\
\hline
42... | PMC2855869_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& & \textbf{Total study population (n = 5655)} & \textbf{All ILI cases (n = 708)} & \textbf{ILI cases during influenza A(H3N2) outbreak period (n = 282)} & \textbf{Influenza A(H3N2) positive cases (n = 79)} & \textbf{Household transmission index... | PMC3302789_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Ascl1}} & \multicolumn{2}{|l|}{\textbf{Neurog1}} & \multicolumn{2}{|l|}{\textbf{Neurog2}} \\
\hline
& \textbf{Chick} & \textbf{Mouse} & \textbf{Chick} & \textbf{Mouse} & \textbf{Chick} & \textbf{Mouse} \\
\hline
nmes... | PMC5142277_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& & \multicolumn{7}{|l|}{\textbf{Two-point LOD score of Family A and B ($\theta$)}} \\
\hline
\textbf{STR marker} & \textbf{Genetic position (cM)} & \textbf{0.00} & \textbf{0.01} & \textbf{0.05} & \textbf{0.10} & \textbf{0.20} & \textbf{0.30... | PMC3413431_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\multicolumn{2}{|l|}{\textbf{Braconids}} & \multicolumn{4}{|l|}{\textbf{Allelic association flies//braconids}} \\
\hline
\textbf{species} & \textbf{samples} & \textbf{N} & \textbf{\%} & \textbf{alleles} & \textbf{Anastrepha host} \\
\hline
D. areolatu... | PMC5127160_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Variables} & \multicolumn{2}{|l|}{\textbf{PMTR (n = 6626)}} & \multicolumn{2}{|l|}{\textbf{PTR (n = 18749)}} & \multicolumn{2}{|l|}{\textbf{No resection (n = 13216)}} \\
\hline
& \textbf{n} & \textbf{\%} & \textbf{n} & \textbf{\%} & \textbf... | PMC5668074_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{(µg/ml) Compound} & \textbf{IL-8 released (pg/ml)} \\
\hline
Medium alone & 24.6 $\pm$ 1.5 \\
\hline
Tryptase 2.0 & 105.2 $\pm$ 5.3* \\
\hline
Elastase 0.3 & 108.4 $\pm$ 13.2* \\
\hline
Benzamidine 30 & 37.6 $\pm$ 4.4 \\
\hline
Leupeptine 30 & 27.4 $\... | PMC1489934_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\
\hline
O1 & 0.0818 (13) & 0.0494 (10) & 0.0792 (12) & −0.0028 (9) & −0.0243 (10) & 0.0088 (8) \\
\hline
O2 & 0.0772 (13) & 0.0656 (11) & 0.0607 (10) & 0.00... | PMC2979542_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Phase} & \textbf{Transcriptional Factors} & \textbf{CDC28/cyclins/CDC genes} & \textbf{Modules containing these factors (ID)} \\
\hline
G1 & SWI4, MBP1, STB1, SWI6, ACE2, SKN7 & CLN3, FUS3, FAR1, CDC36, CDC39, CLN2, CDC37, CDC28, CLN1 & 0, 1, 14, ... | PMC3143111_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{WT (n = 8)} & \textbf{PTRF−/− (n = 6)} \\
\hline
BW (g) & 24.0$\pm$0.6 & 19.7$\pm$0.3** \\
\hline
HW (mg) & 123.7$\pm$5.4 & 107.1$\pm$3.1* \\
\hline
TL (mm) & 16.9$\pm$0.2 & 15.6$\pm$0.1** \\
\hline
HW/BW (mg/g) & 5.15$\pm$0.17 & 5.44$\pm$0.16 \\... | PMC5017623_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\multicolumn{2}{|l|}{\textbf{Starting a LC-SRC—Do’s and Don’ts}} \\
\hline
\textbf{Do} & \textbf{Don’t} \\
\hline
+ Involve students from different college years and faculty (physicians) +Let students organize the LC-SRC and let them carry the responsibility ... | PMC4613888_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\multicolumn{2}{|l|}{\textbf{Incidence and Severity of Treatment-Related AEs by Preferred Term}} & \multicolumn{2}{|l|}{\textbf{Tat 7.5 mg (N = 41)}} & \multicolumn{3}{|l|}{\textbf{Severityc}} & \multicolumn{2}{|l|}{\textbf{Tat 30 mg (N = ... | PMC2978690_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
D—H···A & D—H & H···A & D···A & D—H···A \\
\hline
C3—H3···O1i & 0.93 & 2.95 & 3.687 (6) & 138 \\
\hline
C1—H1···O1ii & 0.98 & 2.47 & 3.266 (5) & 139 \\
\hline
C1—H1···O2ii & 0.98 & 3.48 & 4.331 (6) & 147 \\
\hline
C4—H4···O2iii & 0.93 & 2.54 & 3.371 (5)... | PMC4647347_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{AAA model} & \textbf{P (mmHg)} & \textbf{dAAA,max (cm)} & \textbf{Thickness t (cm)} & \textbf{$\alpha$} & \textbf{$\beta$} & \textbf{Stress (Authors' results) (MPa)} & \multicolumn{2}{|l|}{\textbf{Modified Laplace Equation}} & \multi... | PMC1421417_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Healthy Individuals} & \multicolumn{2}{|l|}{\textbf{Sepsis Patients}} & \textbf{P value*} \\
\hline
& & \textbf{Normal Response to UK} & \textbf{Low Response to UK} \\
\hline
Coagulation Parameters & (N = 10) & (N = 22) & (N = 18) \\
\hline... | PMC4550424_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Primer/Probe name the} & \textbf{Sequence 5′ – 3′} \\
\hline
EP5-8-F & ACGCGCGACCAGCTGCTAACCGTG \\
\hline
P1007ATG-R & TCGCAGCACGGCGCCCTCCCCAT \\
\hline
Ex1end-F & GTCGCTGCCCAAGAATGCAG \\
\hline
EP3-13-R and & TCCGCCCGAAGGTAGTTGATCC \\
\hline
10908-F ... | PMC4838615_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{13}{|l|}{\textbf{Case}} \\
\hline
& \textbf{1} & \textbf{3} & \textbf{4} & \textbf{5} & \textbf{6} & \textbf{7} & \textbf{8} & \textbf{9} & \textbf{10} & \textbf{11} & \textbf{12} & \textbf{13} & \textbf{14} \\
\hline
... | PMC5956044_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Maternal 25(OH)D} & \textbf{Bacteria} & \textbf{\&n} & \textbf{Unadjusted B (95\% CI)} & \textbf{\#Adjusted B (95\% CI)} \\
\hline
Quintile 1 & Bifidobacterium spp. & 176 & 0 (reference) & 0 (reference) \\
\hline
Quintile 2 & & 178 & 0.06 (-0.1... | PMC5679631_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Characteristics} & \textbf{Negative remodeling n = 50} & \textbf{Intermediate remodeling n = 95} & \textbf{Positive remodeling n = 153} & \textbf{P-value} \\
\hline
\\
\hline
Age (years) & 62.18 $\pm$ 10.25 & 63.38 $\pm$ 10.57 & 62.18 $\pm$ 11.... | PMC4472609_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{4}{|l|}{\textbf{LPCa C26:0LPC/C22:0}} & \multicolumn{4}{|l|}{\textbf{\%C26:0LPCa}} \\
\hline
\textbf{Cell type} & \textbf{Mean control} & \textbf{Mean patient} & \textbf{FCb} & \textbf{Pc} & \textbf{Mean control} & \textbf{Mean p... | PMC4553005_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Species} & \textbf{Common Name} & \textbf{Crop/Native} & \textbf{Family} & \textbf{Scorea CC} \\
\hline
Asclepias syriaca L. & Common milkweed & Native & Asclepiadaceae & 0 \\
\hline
Desmodium canadense (L.) DC. & Showy ticktrefoil & Native & Fa... | PMC4468158_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Patient ID} & \textbf{Gender} & \textbf{Age} & \textbf{UPDRS (motor)} & \textbf{Duration of disease} & \textbf{GDS} & \textbf{MMSE} & \textbf{Medication (mg/day)} \\
\hline
1 & F & 49 & 17 & 8 & 1 & 30 & Levodopa (150), benserazide (37.5),... | PMC4997014_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{QTL} & \textbf{Chra} & \textbf{Posb} & \textbf{Rangeb} & \textbf{markerc Peak} & \textbf{Fam.d No. Seg.} & \textbf{e PBON-HOLM} & \textbf{f pG} & \textbf{Freq.g CV} & \textbf{Effecth} & \textbf{CGi} \\
\hline
QFt.HEB25-1b & 1H & 128.... | PMC4426605_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Depth} & \textbf{Bottom duration} & \textbf{Breathing gas} & \textbf{Water temperature(◦C)} & \textbf{\# of divers} & \textbf{Age} & \textbf{Weight (kg)} \\
\hline
33 ft. (10.05 m) & 30 min & Air & 14.96 0.82 $\pm$ & 11 & 42.53 2.17 $\pm$ & ... | PMC5835073_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Age} & \textbf{Click} & \textbf{0.5 kHz} & \textbf{1 kHz} & \textbf{2 kHz} & \textbf{4 kHz} & \textbf{8 kHz} & \textbf{12 kHz} & \textbf{16 kHz} \\
\hline
Age & 1.00 \\
\hline
Click & 0.79* & 1.00 \\
\hline
0.5 kHz & 0.89** & 0.76* ... | PMC3563598_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Mask} & \textbf{L} & & & \textbf{R} & & & \textbf{Mask} & \textbf{Condition} \\
\hline
Incongruent-green group & Condition & Cong-gr & Incong-bl & Incong-gr & Cong-gr & Incong-bl & Incong-gr \\
\hline
& Mean & 2.17 & 2.75 & 2.5... | PMC3341400_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Respondent characteristics} & \textbf{scorea Guideline compliance} & \textbf{p Value} \\
\hline
Specialty & \multicolumn{2}{|l|}{Anaesthesiology (n = 81) 7.9 $\pm$ 1.9 Emergency medicine (n = 31) 6.4 $\pm$ 2.7 Intensive care (n = 81) 7.1 $\pm$ ... | PMC4672560_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\multicolumn{2}{|l|}{\textbf{Variables}} & \textbf{Number of patients} & \textbf{Percentage (\%)} \\
\hline
\textbf{Gender} & \textbf{Male} & \textbf{261865} & \textbf{69.71} \\
\hline
& Female & 113764 & 30.29 \\
\hline
Age & 18- & 112863 & 30.05 \\
\hl... | PMC4914945_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Unique reads} & \textbf{Percent (\%)} & \textbf{Clean reads} & \textbf{Percent (\%)} \\
\hline
Total small RNAs & 3017665 & 100\% & 11243850 & 100\% \\
\hline
Mapping to genome & 153264 & 5.08\% & 4925432 & 43.81\% \\
\hline
\end{tabular}}
\e... | PMC4872230_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{WD-sHCC (n = 31)} & \textbf{HGDN (n = 21)} & \textbf{Sensitivity} & \textbf{Specificity} & \textbf{PPV} & \textbf{NPV} \\
\hline
LIFR negative & 18 & 2 & 58.10\% & 90.50\% & 59.40\% & 90.00\% \\
\hline
CD34 positive & 30 & 8 & 96.80\% & 6... | PMC4466664_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{General practices} \\
\hline
Number of GP practices & 54 \\
\hline
Number of clusters & 40 \\
\hline
Number of included patients per participating cluster, range & 11-79 \\
\hline
\multicolumn{2}{|l|}{Type of practice,\% of} \\
\hline
year, Single-han... | PMC3637448_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{2TCM full input}} & \multicolumn{2}{|l|}{\textbf{Logan full input}} & \multicolumn{2}{|l|}{\textbf{Logan PBIF}} \\
\hline
\textbf{Region} & \textbf{Retest Variability (\%)} & \textbf{ICC} & \textbf{Retest Variability ... | PMC3618181_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Number of samples in TD} & \textbf{Kernel type} & \multicolumn{2}{|l|}{\textbf{SD_GraTrans_Opt_ SamSel+TD_train}} & \multicolumn{2}{|l|}{\textbf{SD_GraTrans_FG+TD_ train}} & \multicolumn{2}{|l|}{\textbf{TD_train}} \\
\hline
& & \textbf{F... | PMC5930507_table_6 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
D—H···A & D—H & H···A & D···A & D—H···A \\
\hline
C21A—H21A···O2Bi & 0.95 & 2.41 & 3.1270 (19) & 132 \\
\hline
C14B—H14B···O3Aii & 0.95 & 2.50 & 3.4345 (17) & 168 \\
\hline
C15B—H15B···O4Aiii & 0.95 & 2.62 & 3.4638 (17) & 148 \\
\hline
C22B—H22B···O2A &... | PMC3414307_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Dose instilled as 10 consecutive inoculations (cfu/20ml)} & \textbf{No. of treated mice} & \textbf{Fertility outcome} \\
\hline
Control (PBS) & 3 & 3/3 (100\%) \\
\hline
104 & 3 & 0/3 (0\%) \\
\hline
106 & 3 & 0/3 (0\%) \\
\hline
108 & 3 & 0/3 (0\%)... | PMC3525590_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Name} & \textbf{Age} & \textbf{Profession} & \textbf{Lifestyle} & \textbf{Type of tracker} & \textbf{Tracking activities} & \textbf{Engagement level} \\
\hline
Joanna & 25–30 & Business development & Very active and attends the gym several t... | PMC6099722_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Huh7} & \textbf{HepG2} & \textbf{SMMC-7721} & \textbf{PLC} & \textbf{MHCCLM3} & \textbf{MHCC97L} & \textbf{SK-Hep1} & \textbf{Hep3B} \\
\hline
AR $\alpha$1 & + & - & - & - & - & - & - & - \\
\hline
AR $\alpha$2 & ++++ & - & - & - & - ... | PMC3643652_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Harmonic order} & \multicolumn{3}{|l|}{\textbf{RCVT /V}} & \multicolumn{3}{|l|}{\textbf{CVT /V}} & \multicolumn{3}{|l|}{\textbf{VT/V}} \\
\hline
& \textbf{100\%+1} & \textbf{100\%+0.8} & \textbf{50\%+0.8} & \textbf{100\%+1} & \textbf{... | PMC6219776_table_5 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Indexes} & \textbf{$\lambda$} & \textbf{F} & \textbf{df1} & \textbf{df2} & \textbf{Sig.} \\
\hline
CA724 (U/mL) & 0.525 & 105.874 & 4 & 469 & $\leq$0.001 \\
\hline
CA242 (U/mL) & 0.551 & 192.145 & 2 & 471 & $\leq$0.001 \\
\hline
TT (s) & 0.511... | PMC6008646_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
Question & Response & \multicolumn{2}{|l|}{AthSD} & \multicolumn{2}{|l|}{AthNoSD} & \multicolumn{2}{|l|}{Unanswered} & \multicolumn{2}{|l|}{Total} \\
\hline
& & N & \% & N & \% & N & \% & N & \% & X2 Pearson and p value \\
\hline
Do you ea... | PMC5070225_table_4 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Attribute cal-} & \textbf{Importance (\%)} \\
\hline
Time Mar- & 23.58 \\
\hline
Confidentiality of & 21.30 \\
\hline
same Result & 20.78 \\
\hline
Feedback & 17.58 \\
\hline
Format & 16.75 \\
\hline
\end{tabular}}
\end{table} | PMC3440922_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Gene symbol} & \textbf{Entrez Gene ID} & \textbf{Forward primer 5' -› 3'} & \textbf{Reverse primer 5' -› 3'} & \textbf{ATa} \\
\hline
\multicolumn{5}{|l|}{mRNA quantification} \\
\hline
fabp1a & 791610 & TAAGCTGACAGCGTTTGTGAAGGG & AGATGCGTCTGCTG... | PMC3483278_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Covariates} & \textbf{Beta} & \textbf{Std. Err} & \textbf{t} & \textbf{p-value} \\
\hline
(Constant) & 2.287 & .126 & 18.096 & .000 \\
\hline
Gender & 2.008 & .069 & 2.117 & .907 \\
\hline
Age & .002 & .002 & 1.511 & .131 \\
\hline
H1N1 & .288 &... | PMC3558489_table_4 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
F2 Refinement on & Secondary atom site location: difference Fourier map \\
\hline
Least-squares matrix: full & Hydrogen site location: inferred from neighbouring sites \\
\hline
R[F2 2$\sigma$(F2)] $>$ = 0.058 & H-atom parameters constrained \\
\hline
wR(F2) ... | PMC2960035_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{dvSalt30}} & \multicolumn{2}{|l|}{\textbf{ecox}} & \multicolumn{2}{|l|}{\textbf{shHeat5}} & \multicolumn{2}{|l|}{\textbf{shCold5}} \\
\hline
\textbf{Method} & \textbf{\#Genes} & \textbf{\%Agree} & \textbf{\#Genes}... | PMC1397872_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& & & \multicolumn{3}{|l|}{\textbf{Peak location}} \\
\hline
\textbf{Brain regions} & & \textbf{Brodmann’s area} & \textbf{x} & \textbf{y} & \textbf{z} & \textbf{Peak t- score} & \textbf{Number of voxels} \\
\hline
MPFC & R & 11 & 9 & 60 & −18... | PMC5064334_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Region} & \textbf{Site} & \textbf{Geographic Coordinates} & \textbf{Accession \#s} & \textbf{Publication Source} & \textbf{On Fig. 1} \\
\hline
Alaska, USA & Toklat glacier & 63.39 N 149.91 W & JF719324-28, 31–38, JF729309 & This study & A \\
... | PMC3163589_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{initially} & \textbf{Mean Change (SD) T1-T2 n = 87} & \textbf{Mean Change (SD) T2 -T3 n=74} & \textbf{Mean Change (SD) T1-T3 n=74} \\
\hline
\textbf{three} \\
\hline
\textbf{T2} \\
\hline
\multicolumn{4}{|l|}{All participants} \\
\hline
ratio Earl... | PMC3533989_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Variables∗ Home Exposure} & \textbf{n (\%)} \\
\hline
\multicolumn{2}{|l|}{Q. 1 Water damage since Hurricane Katrina} \\
\hline
Yes & 180 (34.5) \\
\hline
No & 324 (62.2) \\
\hline
Mean number of months exposed to water damage & 9.1 \\
\hline
\multico... | PMC2948940_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Patients}} & \multicolumn{2}{|l|}{\textbf{Healthy controls}} \\
\hline
& \textbf{Female (n = 85)} & \textbf{Male (n = 44)} & \textbf{Female (n = 85)} & \textbf{Male (n = 44)} \\
\hline
(years)1 Age & 36.9 $\pm$ 10.8 & 34... | PMC4928917_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Basic knowledge of pregnancy} & \textbf{No. of subject with the correct answer} & \textbf{\%} \\
\hline
Antenatal care is important to check my condition during pregnancy (true) & 142 & 97.9 \\
\hline
The first antenatal care examination must be don... | PMC3298506_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{United States}} & \textbf{Canada} & \textbf{Australia} & \textbf{South Korea} \\
\hline
& \textbf{Small molecules} & \textbf{Biologics} \\
\hline
Requirements for stay in approval & Patent litigation & Patent litigatio... | PMC6201583_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Genus} & \textbf{Number of species} & \textbf{Minimum Distance (\%)} & \textbf{Maximum Distance (\%)} \\
\hline
Odontesthes & 2 & 0 & 0.62 \\
\hline
Pimelodus & 2 & 4.06 & 4.21 \\
\hline
Ageneiosus & 2 & 9.78 & 11.65 \\
\hline
Characidium & 2 & 12... | PMC4956254_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{AA} & \textbf{Solution \#} & \textbf{Theoretical Conc. (µg/mL)} & \textbf{Mean Observed Conc. (µg/mL)} & \textbf{a n} & \textbf{Precision (RSD \%)} & \textbf{Accuracy (Recovery \%)} \\
\hline
Leu & \multicolumn{3}{|l|}{1 31.20 29.21 2 160.00... | PMC6099655_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Gene (GSTM3) Loci} & \textbf{Chr:position} & \textbf{primera Forward} & \textbf{primera Reverse} & \textbf{Extension primer} & \textbf{Amplicon size (bp)} \\
\hline
rs1537236 & 1:109736350 & linker-GCCCATAGGCTGCTCTGC & linker- GCCTTAGGAAAAGTTG... | PMC5980204_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Concept} & \textbf{Lig1} & \textbf{Lig3} & \textbf{Lig4} \\
\hline
classical concept & DNA replication & BER (short patch) & NHEJ \\
\hline
& BER (long patch) & mitochondria & V(D)J recombination \\
\hline
& HR & & class switch recombination \\... | PMC4488670_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\multicolumn{2}{|l|}{\textbf{Cell lines}} & \textbf{EMT} & \textbf{Apoptosis} & \textbf{Survival} \\
\hline
\textbf{T47D} & \textbf{control} & \textbf{No} & \textbf{No} & \textbf{Yes} \\
\hline
& Snail & Yes & Yes & No \\
\hline
& Twist & Yes & No & Y... | PMC4837350_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& & \multicolumn{2}{|l|}{\textbf{Female N=1699}} & \multicolumn{2}{|l|}{\textbf{Male N=1522}} \\
\hline
\textbf{Health behaviour} & & \textbf{N} & \textbf{\%} & \textbf{N} & \textbf{\%} & \textbf{p-value} \\
\hline
Smoking & \multicolumn{5}{|l|}{... | PMC3544606_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Clinicopathological characteristics} & & \textbf{n percentile (\%)} \\
\hline
Gender & Male & 62 (69.7) \\
\hline
& Female & 27 (30.3) \\
\hline
Age (years) & $\leq$ 60 & 31 (34.8) \\
\hline
& $>$ 60 & 58 (65.2) \\
\hline
Gross classification & U... | PMC6043992_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Variable} & \multicolumn{4}{|l|}{\textbf{Wealth quartile*}} \\
\hline
& \textbf{Most poor (n = 127)} & \textbf{Below average (n = 126)} & \textbf{Above average (n = 126)} & \textbf{Most wealthy (n = 125)} & \textbf{MW:MP**} & \textbf{c2} ... | PMC2942820_table_5 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{1} & \textbf{GDS Groups 2} & \textbf{3} & \textbf{p-value} \\
\hline
\\
\hline
Number Women (\%) & 21 (80.7) & 21 (84) & 21 (67.7) & 0.34 \\
\hline
Number isiXhosa (\%) & 22 (88.5) & 23 (95.7) & 30 (96.8) & 0.22 \\
\hline
Age median (IQR) & ... | PMC3356227_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{5}{|l|}{\textbf{Image set}} \\
\hline
& \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} \\
\hline
Smallest gland visualized & 260 & 260 & 420 & 550 & 260 \\
\hline
Mean weight of FN (mg) & 300 & 420 & 485 & 420 & 300 \\... | PMC3564434_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Model} & \textbf{Genotype} & \textbf{Case} & \textbf{Control} & \textbf{OR* CI**) (95\%} & \textbf{p-value} & \textbf{AIC***} & \textbf{BIC****} \\
\hline
Codominant & \multicolumn{4}{|l|}{C/C 76 (67.9\%) 50 (53.8\%) 1.00 C/G 16 (14.3\%) 1... | PMC5960056_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{PCT test} & \textbf{Cutoff 0.5 ng /mL} & \textbf{Cutoff 2.0 ng/mL} & \textbf{Cutoff 10 ng/mL} \\
\hline
Sensitivity & 0.52 [0.37–0.67] & 0.20 [0.10–0.34] & 0.02 [0.00–0.13] \\
\hline
Specificity & 0.76 [0.66–0.83] & 0.91 [0.84–0.95] & 0.97 [0.92–0... | PMC2792948_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Gene name} & \textbf{Gene annotation} & \textbf{RefSeq ID} & \textbf{Sequence} & \textbf{Amplicon size} \\
\hline
DEFA 1-3* & Defensin, alpha 1 to 3 & NM_005218.3 & CCTGCCTAGCTAGAGGATCTGTG & 222 bp \\
\hline
& & NM_005217.2 & TGTTTTTCCTTGAGCCT... | PMC2984430_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Country} & \textbf{Number of authors} \\
\hline
Poland & 109 \\
\hline
Japan & 62 \\
\hline
China & 38 \\
\hline
Canada & 10 \\
\hline
Germany & 10 \\
\hline
Russia & 4 \\
\hline
USA & 4 \\
\hline
Austria & 3 \\
\hline
Italy & 2 \\
\hline
Netherlands ... | PMC6044251_table_8 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{|l|}{\textbf{Clinical phases}} & \textbf{Total} & \textbf{p} \\
\hline
& \textbf{Indeterminate (n = 16)} & \textbf{CPND (n = 17)} & \textbf{CPD (n = 21)} \\
\hline
& & & & \textbf{(n = 54)} \\
\hline
Age & 57.8 $\pm$ 11.9 & 54.... | PMC4652401_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{All oligo arrays (service)} & \textbf{Oligo arrays following normal karyotype} & \textbf{Oligo arrays as first line test} \\
\hline
Total patients & 2414 & 1245 & 1169 \\
\hline
Abnormal patients & 585 (24\%) & 325 (26\%) & 260 (22\%) \\
\hline... | PMC2885406_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Method} & \textbf{100\%} & \textbf{50\%} & \textbf{20\%} & \textbf{10\%} \\
\hline
SSCS & 2.16 & 1.42 & 1.22 & 1.17 \\
\hline
EDCS & 2.44 & 1.41 & 1.1 & 1.08 \\
\hline
ResNet & 0.136 & 0.132 & 0.131 & 0.131 \\
\hline
GoogLeNet & 0.100 & 0.098 & ... | PMC5712811_table_4 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
F2 Refinement on & Primary atom site location: structure-invariant direct methods \\
\hline
Least-squares matrix: full & Secondary atom site location: difference Fourier map \\
\hline
R[F2 2$\sigma$(F2)] $>$ = 0.064 & Hydrogen site location: inferred from nei... | PMC2979682_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{RIP} & \multicolumn{2}{|l|}{\textbf{Source}} & \textbf{Against viruses} & \textbf{Reference} \\
\hline
& \textbf{Scientific name} & \textbf{Tissue} \\
\hline
Alpha-momorcharin & Momordica charantia & Seeds & Chilli veinal mottle virus, Cucumber... | PMC5811460_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Type of sample} & \textbf{Sample no.} & \multicolumn{2}{|l|}{\textbf{l−1 Results, CFU (Log10)}} \\
\hline
& & \textbf{Culture method} & \textbf{IMS method} \\
\hline
Water Matrix & 1 & ND & ND \\
\hline
& 2 & ND & ND \\
\hline
& 3 & ND & ND \\... | PMC4436101_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Order/Family} & \textbf{Species} & \multicolumn{2}{|l|}{\textbf{La Parva}} & \multicolumn{2}{|l|}{\textbf{Piedra Numerada}} \\
\hline
& & \textbf{N} & \textbf{\%} & \textbf{N} & \textbf{\%} \\
\hline
\multicolumn{6}{|l|}{Lepidoptera} \\
\hli... | PMC3088671_table_3 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Coverage} & \textbf{Pool Size} & \textbf{Match} & \textbf{Relocation} & \textbf{Inversion} & \textbf{Redundancy} & \textbf{Coverage} & \textbf{Scaffold N50} & \textbf{Number of scaffolds} \\
\hline
15L + 5P (3kb) & 3M & 0.506 & 0.872 & 0... | PMC3224119_table_4 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Feature Selection Algorithm} & \textbf{Selected Features} & \textbf{Best CV rate} \\
\hline
SVM with No Feature Selection & & 95 \\
\hline
SVM with F-score Selection & 3,6,7,9,10,39,52,57,59,60,72,80,81,89,90 & 100.0 \\
\hline
Correlation Based Sel... | PMC3293912_table_5 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Primers} & \textbf{(5′-3′) Upper primer sequence} & \textbf{(5′-3′) Lower primer sequence} \\
\hline
COI-COIII & GGAAATTGACTTGTGCCT & TTGTATGTTTACCTTGGA \\
\hline
COIII-ND4 & AAAGGATTACGATGAGGT & GGTCTTGTTATTGGTGGA \\
\hline
ND4-Cytb & CGTCTATGTAAAC... | PMC3335176_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& & \multicolumn{3}{|l|}{\textbf{Statistics}} & \multicolumn{2}{|l|}{\textbf{95\% Confidence}} \\
\hline
& & \textbf{n} & \textbf{Mean} & \textbf{SD} & \textbf{Interval} & \textbf{for Mean} \\
\hline
\textbf{Clusters to} & \textbf{Group} & & &... | PMC3419208_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Factor} & \textbf{R2} & \textbf{P-value} \\
\hline
Fasting plasma glucose & 0.0120 & NS \\
\hline
HbA1c & 0.0731 & .040 \\
\hline
Systolic blood pressure & 0.0133 & NS \\
\hline
Diastolic blood pressure & 0.0301 & NS \\
\hline
Total cholesterol (TC)... | PMC2656910_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{Theoretical} & \textbf{Firnberg et al. results [24]} & \multicolumn{2}{|l|}{\textbf{QuikChange Primers}} & \multicolumn{2}{|l|}{\textbf{Scripted Pfunkel Primers}} \\
\hline
& & \textbf{Plated} & \textbf{Plated} & \textbf{Culture} & \tex... | PMC4366243_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Items} & \textbf{FESm (n = 61)} & \textbf{FESf (n = 63)} & \textbf{HCm (n = 50)} & \textbf{HCf (n = 52)} & \textbf{p} \\
\hline
Age & 24.31 (6.57) & 24.62 (6.82) & 24.80 (6.74) & 24.71 (6.98) & 0.982 \\
\hline
Education years & 13.13 (2.49) & ... | PMC4519942_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Sample Number} & \textbf{Total carbonate [wt.\%]} & \textbf{Aragonite [wt.\%]} & \textbf{Calcite magnesian [wt.\%]} & \textbf{Calcite [wt.\%]} & \textbf{Quartz [wt.\%]} & \textbf{Halite [wt.\%]} & \textbf{Gypsum [wt.\%]} & \textbf{Or... | PMC5957445_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Nutrients and food groups} & \multicolumn{2}{|l|}{\textbf{ICC (FFQ1 vs FFQ2)}} \\
\hline
& \textbf{a Crude} & \textbf{b Energy-adjusted} \\
\hline
Energy (kcal) & 0.64 & - \\
\hline
Protein (g) & 0.59 & 0.42 \\
\hline
Fat (g) & 0.43 & 0.38 \\
\hlin... | PMC3092766_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Morocco} & \textbf{Tunisia} \\
\hline
Magnitude of immigration & Low & High \\
\hline
Politicization of immigration & High & Low \\
\hline
Magnitude of political change & Low & High \\
\hline
\end{tabular}}
\end{table} | PMC5830462_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
D—H···A & D—H & H···A & D···A & D—H···A \\
\hline
N2—H2A···N1 & 0.86 & 2.67 & 3.300 (15) & 131 \\
\hline
\end{tabular}}
\end{table} | PMC3343968_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& & \multicolumn{2}{|l|}{\textbf{Flow rate 0.02 $\pm$ (mL min−1)}} & \multicolumn{2}{|l|}{\textbf{pH $\pm$ 0.1}} & \multicolumn{2}{|l|}{\textbf{Mobile phase composition 2\% $\pm$ (Acetonitrile: Phosphate buffer)}} & \multicolumn{2}{|l|}{\tex... | PMC5722889_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
F2 Refinement on & Primary atom site location: structure-invariant direct methods \\
\hline
Least-squares matrix: full & Secondary atom site location: difference Fourier map \\
\hline
R[F2 2$\sigma$(F2)] $>$ = 0.029 & Hydrogen site location: difference Fourie... | PMC3238708_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Parameter [statistic]} & \textbf{All patients} & \multicolumn{3}{|l|}{\textbf{Olanzapine vs. non-olanzapine}} & \multicolumn{3}{|l|}{\textbf{Risperidone vs. non-risperidone}} & \multicolumn{3}{|l|}{\textbf{Haloperidol vs. non-haloper... | PMC2507712_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\
\hline
O001 & 0.0320 (5) & 0.0242 (4) & 0.0153 (4) & 0.0015 (4) & 0.0037 (4) & −0.0013 (3) \\
\hline
N2 & 0.0218 (5) & 0.0184 (4) & 0.0150 (4) & 0.0016 (4)... | PMC3394032_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& & \textbf{Female* (n = 881)} & \textbf{Male* (n = 1781)} \\
\hline
\multicolumn{4}{|l|}{Sociodemographics} \\
\hline
\multicolumn{2}{|l|}{Median age, years (IQR)} & 28 (25–32) & 30 (28–34) \\
\hline
Education, n (\%) & No education & 2 (0.3) & 2 (0.2)... | PMC4673839_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Strains} & \textbf{Identities/HSP length} & \textbf{Probability $>$ 70 \%} & \textbf{Probability $>$ 79 \%} \\
\hline
21420T S. nematodiphila DSM & 57.90 \% $\pm$ 2.77 & 45.06 \% & 35.51 \% \\
\hline
2792T S. marcescens LMG & 56.40 \% $\pm$ 2.75 &... | PMC5094094_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Model parameters} & \textbf{Actinoplanes sp. SE50/110 (iYLW1028)} & \textbf{S. coelicolor A3(2) Borodina et al., 2005} & \textbf{M. tuberculosis H37Rv Jamshidi and Palsson, 2007} \\
\hline
\multicolumn{4}{|l|}{GENOME FEATURE} \\
\hline
Genome size... | PMC4479805_table_1 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Objective} & \textbf{Target} & \textbf{Size (bp)} & \textbf{Forward Primer (5′–3′)} & \textbf{Reverse Primer (3′–5′)} \\
\hline
TOPO® Cloning (standard curve) & COI & 356 & AGC CGT CAG AGA CAG TAA & CGT GAC CAA GCC CTA ATA AA \\
\hline
& ATP6 &... | PMC4834350_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Topics} & \textbf{Learning objectives (At the end of this workshop the students will be able to …)} & \textbf{Learning activities} & \textbf{Approximate time (min)} \\
\hline
Introduction & … describe the importance and objectives of empathy-build... | PMC6094453_table_0 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Mediator} & \textbf{Estimate} & \textbf{95\% CI} \\
\hline
\multicolumn{3}{|l|}{Mothers} \\
\hline
Hyperarousal & 0.084 & 0.011–0.222 \\
\hline
Internal avoidance & -0.011 & -0.058–0.004 \\
\hline
External avoidance & 0.001 & -0.043–0.054 \\
\hline
... | PMC4871492_table_2 | |
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{2009 (H1N1) Influenza CAP (n = 22)} & \textbf{CAP, other Etiology (n = 291)} & \textbf{Odds ratio (95\% CI)} & \textbf{valuea P} \\
\hline
\multicolumn{5}{|l|}{Therapy, No. (\%)} \\
\hline
IV abx therapy & 22 (100) & 291 (100) \\
\hline
oselt... | PMC3469650_table_2 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.