text stringclasses 10
values | source stringclasses 1
value |
|---|---|
Abstract In hexaploid bread wheat ( Triticum aestivum L. em. Thell), ten members of the IWMMN ( International Wheat Microsatellites Mapping Network ) collaborated in extending the microsatellite (SSR = simple sequence re-peat) genetic map. Among a much larger number of mi-crosatellite primer pairs developed as a part o... | 10.1007s00122-002-0865-9.pdf |
Gupta et al. 1999 for a review). Physical maps for all 21 chromosomes involving a sizable proportion of the genet-ically mapped loci are also available (Gill et al. 1993;Kota et al. 1993; Hohmann et al. 1994; Ogihara et al. 1994; Delaney et al. 1995a, b; Mickelson-Young et al. 1995; Varshney et al. 2001). These genetic... | 10.1007s00122-002-0865-9.pdf |
W7984 and the wheat variety Opata 85, the parents of the ITMI pop. Fifty eight (58) primer pairs (33%) were found to identify polymorphism, and were therefore usedfor genotyping the set of 70 RILs from the ITMI pop. These 70 RILs have been found to be adequate for adding new molecular markers on the existing map andare... | 10.1007s00122-002-0865-9.pdf |
416 Table 2Primer sequences of 58 microsatellites used for mapping Microsatellites Forward primer (5 ′3′) Reverse primer (5 ′3′) Chromosome/arma wmc24 GTGAGCAATTTTGATTATACTG TACCCTGATGCTGTAATATGTG 2A wmc25 TCTGGCCAGGATCAATATTACT TAAGATACATAGATCCAACACC 2AS, 2BS, 2DSwmc27 AATAGAAACAGGTCACCATCCG TAGAGCTGGAGTAGGGCCAAAG-wmc... | 10.1007s00122-002-0865-9.pdf |
417 | 10.1007s00122-002-0865-9.pdf |
418 Fig. 1(continued) | 10.1007s00122-002-0865-9.pdf |
419 Fig. 1(continued) | 10.1007s00122-002-0865-9.pdf |
(wmc25, wmc43, wmc48, wmc175, wmc181, wmc329) each detected two homoeoloci (Table 3). In at least twocases (wmc96, wmc166), the multiple loci amplified bythe same primer pair belonged to non-homoeologouschromosomes; in four other cases (wmc169, wmc173,wmc322, wmc323) multiple loci were available butcould not be assigne... | 10.1007s00122-002-0865-9.pdf |
(personal communication, D. Somers; no details were made available). Thus the remaining wmc and other ad-ditional microsatellite markers will be mapped in duecourse of time. The WMC has already initiated the development of another set of wmcmarkers in its second phase with fewer members, and it may also undertake desig... | 10.1007s00122-002-0865-9.pdf |
Harker N, Rampling L, Shariflou M, Hayden M, Holton TA, Morell M, Sharp PJ, Henry RJ, Edwards KJ (2001) Microsat-ellites as markers for Australian wheat improvement. Aust J Agric Res 52:1121-1130 Hohmann U, Endo TR, Gill KS, Gill BS (1994) Comparison of genetic and physical maps of group 7 chromosomes from Triticum aes... | 10.1007s00122-002-0865-9.pdf |
README.md exists but content is empty.
- Downloads last month
- 6