image imagewidth (px) 205 980 | latex stringlengths 132 39.9k | filename stringlengths 18 19 |
|---|---|---|
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Name} & \textbf{Description} \\
\hline
C2 & complement component 2 \\
\hline
PMP22 & peripheral myelin protein 22 \\
\hline
SDC1 & syndecan 1 \\
\hline
COL11A1 & collagen, type XI, alpha 1 \\
\hline
ITGB4 & integrin, beta 4 \\
\hline
... | PMC2716678_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \textbf{True normal tissues} & \textbf{True tumor tissues} \\
\hline
Predicted as normal tissues & 1 & 1 \\
\hline
Predicted as tumor tissues & 5 & 41 \\
\hline
\end{tabular}
\end{table} | PMC2716681_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& & Batch I Analysis \\
\hline
& Organ donor (N) & Adjacent to tumor (A) & Tumor (T) & Total \\
\hline
Liver & 21 & 30 & 43 & 94 \\
\hline
Prostate & 23 & 59 & 66 & 148 \\
\hline
& & Batch II Analysis \\
\hline
& Organ donor (N) &... | PMC2716681_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{Liver vs. Prostate} \\
\hline
& liv→liv & pro→liv & pro→pro & liv→pro \\
\hline
All genes & 96.5\% & 66.3\% & 93.9\% & 47.4\% \\
\hline
Common signature & 96.5\% & 93.0\% & 98.8\% & 96.3\% \\
\hline
& \multicolu... | PMC2716681_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{Liver} \\
\hline
& liv→liv & pro→liv & pro→pro & liv→pro \\
\hline
All genes & 96.51\% & 66.28\% & 93.94\% & 47.36\% \\
\hline
Common signature & 97.67\% & 97.67\% & 95.55\% & 94.14\% \\
\hline
& \multicolumn{2}... | PMC2716681_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& & \multicolumn{4}{c|}{\textbf{Test data}} \\
\hline
& & \textbf{Liver} & \textbf{Prostate} & \textbf{Lung} & \textbf{Bladder} \\
\hline
\multirow{4}{*}{Training data} & \textbf{Liver} & 96.5\% (69)* & (225)+ 94.1\% & (119)+ 94.7... | PMC2716681_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{A2780}} & \multicolumn{2}{c|}{\textbf{A2780}/CDDP} & \multicolumn{2}{c|}{\textbf{SKOV3}} \\
\hline
& \textbf{\textbf{\textbf{control}}} & \textbf{\textbf{\textbf{BRCA1 si}}} & \textbf{\textbf{\textbf{... | PMC2716781_table_0 | |
\begi\textbf{n}{table}
\ce\textbf{n}teri\textbf{n}g
\label{tab:tablelabel}
\begi\textbf{n}{tabular}{|l|l|l|l|l|l|}
\hli\textbf{n}e
\textbf{Group} & \textbf{Site} & \textbf{n} & Wome\textbf{n}/Me\textbf{n} & \textbf{Age (years)} & \textbf{BMI (kg/m2)} \\
\hli\textbf{n}e
\multirow{4}{*}{Co\textbf{n}trol} & UK & 21 & 20/1... | PMC2717045_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{5}{c|}{\textbf{Risk groups}} \\
\hline
\textbf{Country} & \textbf{MSM} & \textbf{IDUs} & \textbf{Heterosexuals} & \textbf{Others} & \textbf{Unknown} & \textbf{Sum} \\
\hline
United Kingdom (GBR) & 59 (66\%) & 0 (0\%)... | PMC2717046_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{White (291)} & \textbf{Hispanic (22)} & \textbf{Black (12)} & \textbf{Asian (5)} & \textbf{Other (15)} \\
\hline
SNAP & 0.709 & 0.750 & 1.240 & 0.818 & 0.659 \\
\hline
PAML & 0.839 & 0.826 & 1.411 & 1.346 & 0.751 \\
\hline
... | PMC2717047_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Race}} & \multicolumn{2}{c|}{\textbf{Race} by treatment} \\
\hline
\textbf{Method} & \textbf{\textbf{ANOVA}} & \textbf{Corrected pairwise t-tests} & \textbf{\textbf{ANOVA}} & \textbf{lm coefficient} \\
\hl... | PMC2717047_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Analyte} & \textbf{Collision energy (eV)} & \textbf{Collision exit potential (V)} & \textbf{Declustering potential (V)} & \textbf{Entrance potential (V)} \\
\hline
myo-inositol & -10.0 & -5.0 & -70.0 & -10.0 \\
\hline
[2H6]-myo-... | PMC2717050_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Time} & \textbf{Mean} & \textbf{SD} & \textbf{N} \\
\hline
1 & 6.33 & 4.1 & 45 \\
\hline
2 & 3.16 & 3.9 & 32 \\
\hline
3 & 0.88 & 2.47 & 17 \\
\hline
\end{tabular}
\end{table} | PMC2717051_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multirow{2}{*}{\textbf{Time 1 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} & \multirow{2}{*}{\textbf{Time 2 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}}... | PMC2717051_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Time} & \textbf{Mean} & \textbf{SD} & \textbf{N} \\
\hline
1 & 12.13 & 3.21 & 45 \\
\hline
2 & 13.48 & 3.48 & 31 \\
\hline
3 & 15 & 3.48 & 17 \\
\hline
\end{tabular}
\end{table} | PMC2717051_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multirow{2}{*}{\textbf{Time 1 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}} & \multirow{2}{*}{\textbf{\textbf{\textbf{N}}}} & \multirow{2}{*}{\textbf{Time 2 Mean}} & \multirow{2}{*}{\textbf{\textbf{\textbf{SD}}}}... | PMC2717051_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Parameters} & \textbf{Oromo folksongs} & \textbf{Remark} \\
\hline
Lyrics & More than one issue is addressed & With the exception to some of the folksongs, most of them describe various and more than one issues \\
\hline
Vocal style... | PMC2717052_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Patient characteristics} & \textbf{Number of patients} & \textbf{HER 2 +(\%)} \\
\hline
Total Patients & 73 & 21 (28.8) \\
\hline
Sex \\
\hline
Male & 69 & 19 (27.5) \\
\hline
Female & 4 & 2 (50) \\
\hline
Stage \\
\hline
Stage IIIB... | PMC2717055_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{HER 2} & \textbf{CR+PR+SD} & \textbf{PD} \\
\hline
\textbf{HER 2} (+) & 13 (63.9) & 8(38.1\%) \\
\hline
\textbf{HER 2} (-) & 48 (92.3\%) & 4(7.7\%) \\
\hline
\end{tabular}
\end{table} | PMC2717055_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Patient characteristics} & \textbf{Number of patients} & \textbf{CR+PR+SD} & \textbf{PD} \\
\hline
Total Patients & 73 & 61(83.6\%) & 12 (16.4\%) \\
\hline
Sex \\
\hline
Male & 69 & 58 (84\%) & 11 (16\%) \\
\hline
Female & 4 & 3(7... | PMC2717055_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{GO term} & \textbf{Level1} & \textbf{Genes2} & \textbf{ORFs3} & \textbf{Prot. DIP4} & \textbf{Prot.DIP/ ORFs (\%)} & \textbf{Prot. GOLD5} & \textbf{Prot.GOLD/ ORFs (\%)} \\
\hline
Developmental process (BP) & 1 & 768 & 757... | PMC2717056_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
GO term & N (P) DIP & N (P) GOLD & GO term & N (P) DIP & N (P) GOLD \\
\hline
Developmental process (32502) & 632 (16) & 257 (8) & Organelle envelope (31967) & 230 (12) & 69 (2) \\
\hline
Reproductive developmental process (3006) & 26... | PMC2717056_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{GO TERMS} & \textbf{Coverage} & \textbf{Purity (Average)} & \textbf{Ambiguity} & \textbf{Φ(average $\pm$ s.e.m.)} \\
\hline
Developmental process (32502) & 63.6\% (402/632) & 62.2\% & 13.0\% (74/570) & 0.46 $\pm$ 0.02 \\
\hline
... | PMC2717056_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{GO TERMS} & \textbf{Coverage} & \textbf{Purity (Average)} & \textbf{Ambiguity} & \textbf{Φ(average $\pm$ s.e.m.)} \\
\hline
Developmental process (32502) & 83.3\% (214/257) & 82.0\% & 7.2\% (16/222) & 0.51 $\pm$ 0.06 \\
\hline
R... | PMC2717056_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& \textbf{A priori Genetic Group} & \textbf{Geneclass} & & & \textbf{Structure} \\
\hline
& & RFLP & SSR & RFLP & & SSR \\
\hline
Individuals & & & & Ancestry (\%) & CI & Ancestry (\%) & CI \\
\hline
AC663 & A & E 1.445 &... | PMC2717059_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{SSR\RFLP} & \textbf{A} & \textbf{B} & \textbf{C} & \textbf{D} & \textbf{E} \\
\hline
\textbf{A} & 0 & 0.29 & 0.50 & 0.67 & 0.30 \\
\hline
\textbf{B} & 0.33 & 0 & 0.51 & 0.67 & 0.30 \\
\hline
\textbf{C} & 0.30 & 0.24 & 0 & 0.54... | PMC2717059_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Variable, \% unless otherwise indicated} & \textbf{EuroSCORE > 20, n = 237} & \textbf{EuroSCORE $\leq$ 20, n = 1,184} \\
\hline
Critical preoperative state* & 24.5 & 1.0 \\
\hline
Emergency surgery & 10.1 & 0.9 \\
\hline
Concomitant... | PMC2717063_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Outcome, \%} & \textbf{EuroSCORE > 20, n = 237} & \textbf{$\leq$ EuroSCORE 20, n = 1,184} & \textbf{P} \\
\hline
Mortality (in-hospital or within 30 days of surgery) & 11.4 & 3.2 & <0.0001 \\
\hline
In-hospital events \\
\hline
Ve... | PMC2717063_table_1 | |
\begi\textbf{n}{table}
\ce\textbf{n}teri\textbf{n}g
\label{tab:tablelabel}
\begi\textbf{n}{tabular}{|l|l|l|l|l|l|l|l|l|}
\hli\textbf{n}e
\textbf{WHO} & \textbf{n} & \textbf{Age (yr)} & \textbf{MGb(\%)} & \textbf{Weight (g)} & \textbf{Masaoka I} & \textbf{Masaoka I}I & \textbf{Masaoka I}II & \textbf{Masaoka I}V \\
\hli\... | PMC2717064_table_0 | |
\begi\textbf{n}{table}
\ce\textbf{n}teri\textbf{n}g
\label{tab:tablelabel}
\begi\textbf{n}{tabular}{|l|l|l|l|l|l|l|}
\hli\textbf{n}e
\textbf{Masaoka} & \textbf{n} & \textbf{R0-status} & \textbf{N1} & \textbf{M1} & Recurre\textbf{n}ce & \textbf{5-year survival (\%)} \\
\hli\textbf{n}e
I & 42 & 42 (100\%) & 0 (0\%) & 0 (... | PMC2717064_table_1 | |
\begi\textbf{n}{table}
\ce\textbf{n}teri\textbf{n}g
\label{tab:tablelabel}
\begi\textbf{n}{tabular}{|l|l|l|l|l|l|}
\hli\textbf{n}e
\textbf{Characteristics} & \textbf{n} & \textbf{Pseudocapsula complete} & Pseudocapsula i\textbf{n}complete & Pseudocapsula \textbf{n}o capsula & \textbf{p-valueb} \\
\hli\textbf{n}e
Masaok... | PMC2717064_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Risk factor} & \textbf{Univariate analysis} & \multicolumn{3}{c|}{\textbf{Multivariate analysisc}} \\
\hline
& \textbf{\textbf{p value}b} & \textbf{Relative risk} & \textbf{95\% Confidence interval} & \textbf{p value} \\
\hline... | PMC2717064_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Examination subject} & \textbf{Date} & \textbf{Format} & \textbf{Reliability (KR20)} \\
\hline
\multirow{2}{*}{Generic clinical knowledge} & March & EMQ & 0.758 \\
\hline
August & EMQ & 0.730 \\
\hline
Care of the Elderly and & Ma... | PMC2717066_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Intervention group n = (\%)} & \textbf{Control group n = (\%)} & \textbf{Total n = (\%)} & \textbf{Group differences} & \textbf{p value} \\
\hline
& \multicolumn{2}{c|}{\textbf{Total n = (\%)}Tutor} \\
\hline
Total & 6 & 6... | PMC2717066_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Ethnic group} & \textbf{Condition} & \textbf{Mean written z-score (SD)} & \textbf{Mean OSCE z-score (SD)} & \textbf{N} \\
\hline
\multirow{2}{*}{W} & Intervention & 0.063 (0.90) & 0.271 (0.96) & 79 \\
\hline
Control & 0.244 (1.0... | PMC2717066_table_2 | |
\begin{\textbf{t}able}
\cen\textbf{t}ering
\label{\textbf{t}ab:\textbf{t}ablelabel}
\begin{\textbf{t}abular}{|l|l|l|l|l|l|l|l|}
\hline
\\textbf{t}ex\textbf{t}bf{Dimensions} & \\textbf{t}ex\textbf{t}bf{Word ca\textbf{t}egories} & \\textbf{t}ex\textbf{t}bf{Type of word} & \\textbf{t}ex\textbf{t}bf{Group wi\textbf{t}h hig... | PMC2717066_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Characteristics} & \textbf{Study aggregate} \\
\hline
Age (year), Median (IQR*) & 35 (33–37) \\
\hline
Gender (W:M) & 43\%/57\% \\
\hline
Married & 65\% \\
\hline
Time from medical school to residency training (years), Median (IQR*) &... | PMC2717068_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Characteristics} & \textbf{Above PG level median (n = 18)} & \textbf{Below PG level median (n = 33)} & \textbf{*P value} \\
\hline
Age, median (range) in years & 33 (31–40) & 36 (31–47) & < 0.05 \\
\hline
Male:Female (ratio) & 9:9... | PMC2717068_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Characteristics} & \textbf{Above US Median (n = 13)} & \textbf{Below US Median (n = 38)} & \textbf{*P value} \\
\hline
Age, median (range) in years & 35 (32–42) & 35.5 (31–47) & NS \\
\hline
**Male/Female (ratio) & 11:2 & 18: 20 &... | PMC2717068_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{#Characteristics} & \textbf{Above US Median} & \textbf{Below US Median} & \textbf{P value} \\
\hline
\multicolumn{2}{c|}{(Above median} \\
\hline
Male/Female (ratio) (unadjusted analysis) & 22:10 & 7: 12 & < 0.05 \\
\hline
#USMLE ... | PMC2717068_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Characteristics (units)} & \textbf{Fellowship pursuing residents (n = 8)} & \textbf{Others (n = 43)} & \textbf{P value} \\
\hline
Age, median (range) in years & 33 (31 – 39) & 35 (31–47) & NS \\
\hline
Male/Female (ratio) & 4:4 & ... | PMC2717068_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Question} & \multicolumn{7}{c|}{\textbf{Likert Scale}} \\
\hline
\textbf{How valuable has the student housing conditions survey, and discussion of findings, been for you?} & \textbf{Extremely valuable} & \textbf{1} & \text... | PMC2717069_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Groups}} \\
\hline
& \textbf{Hypoglycemic (n = 436)} & \textbf{Controls (n = 434)} & \textbf{P-value} \\
\hline
Cervical ripening & 36 (8\%) & 38 (9\%) & 0.792 \\
\hline
Induction of labor & 129 (30\%) & 87... | PMC2717071_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Group}} \\
\hline
& \textbf{Hypoglycemic (n = 436)} & \textbf{Controls (n = 434)} & \textbf{P-value} \\
\hline
Birth weight (gm) (med, Q1-Q3) & 3240 (2928–3550) & 3313 (2980–3690) & 0.008 \\
\hline
Birth we... | PMC2717071_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Outcome} & \textbf{OR} & \textbf{\textbf{95\% CI}} & \textbf{RR} & \textbf{\textbf{95\% CI}} & \textbf{p-value} \\
\hline
Preeclampsia & 3.13 & 1.51–6.51 & 2.98 & 1.49–5.78 & 0.002 \\
\hline
Induction of labor & 1.75 & 0.83–1.... | PMC2717071_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Code} & \textbf{Clinician Comments} \\
\hline
Assessment of Severity & "By how much the patient describes the itch. Like, if they say, it wakes me up at night, or it keeps me up at night, or it's relentless, or it drives me crazy, I k... | PMC2717072_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Focus Groups}} \\
\hline
& \textbf{Patients with Mild Psoriasis (N = 8)} & \textbf{Patients with Severe Psoriasis (N = 31)} \\
\hline
Female sex, n (\%) & 5 (63) & 17 (55) \\
\hline
Age, mean years (range) & ... | PMC2717072_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Code/domain} & \textbf{Patient Comment (Severity of Psoriasis)} \\
\hline
Symptoms/itch & "You itch a lot. Scratch a lot, I mean." (Severe) "Scratch to relieve." (Severe) "It will spread over my whole body, the itching. I'll get scabs... | PMC2717072_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Patients with Mild Disease (N = 8)} & \textbf{Patients with Severe Disease (N = 31)} & \textbf{All Patients (N = 39)} \\
\hline
Patients rating itch as the most important symptoma \\
\hline
No. of patients, n & 8 & 23 & 31 \\
\... | PMC2717072_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Total Responses} & \textbf{FG 1 vs FG 2} & \textbf{FG 1–2 vs FG 3} & \textbf{FG 1–3 vs FG 4} & \textbf{FG 1–4 vs FG 5} \\
\hline
Symptoms \\
\hline
Itch & 19 & 4 vs 4 & 8 vs 3 & 11 vs 5 & 16 vs 3 \\
\hline
Bleeding & 13 & 3... | PMC2717072_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& & \multicolumn{2}{c|}{\textbf{Sinus rhythm at 12 +- 3 days}} \\
\hline
& \textbf{All} & \textbf{Yes} & \textbf{No} \\
\hline
Patients, n & 111 & 56 & 55 \\
\hline
Age, years & 67 $\pm$ 12 & 66 $\pm$ 11 & 67 $\pm$ 13 \\
\hline
Weight,... | PMC2717073_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\multirow{2}{*}{\textbf{New symptoms scale}} & \multirow{2}{*}{\textbf{ICC (AF at 12 $\pm$ 3 days)}} & \multirow{2}{*}{\textbf{Lower 95\% CI limit for ICC}} \\
\hline
\\
\hline
Dyspnoea at rest & 0.82 & 0.61 \\
\hline
Dyspnoea on exertion ... | PMC2717073_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Items} & \textbf{Dyspnoea at rest} & \textbf{Dyspnoea on exertion} & \textbf{Limitations in working} & \textbf{Limitations in daily life} & \textbf{Discomfort due to AF} & \textbf{Fatiguedue to AF} & \textbf{Anxiety due to... | PMC2717073_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Item number} & \textbf{Raw count} & \textbf{Measure} & \textbf{Realse} & \multicolumn{2}{c|}{\textbf{Infit}} & \multicolumn{2}{c|}{\textbf{Outfit}} & \textbf{Score} \\
\hline
& & & & \textbf{\textbf{MNSQ}} & \textbf{... | PMC2717073_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Score} & \textbf{Description} \\
\hline
0 & No lesion \\
\hline
1 & Hyperaemic area with erected pili \\
\hline
2 & Moist, exudative and hyperaemic area with intact epidermis \\
\hline
3 & Exudative area, exposed corium with no signs ... | PMC2717074_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
N° of cases \\
\hline
Total & 68 \\
\hline
Distribution of parity groups (\%) \\
\hline
Primiparous & 75.0 \\
\hline
Multiparous & 25.0 \\
\hline
Distribution of lactation stage groups (\%) \\
\hline
DIM* 0–120 & 35.3 \\
\hline
DIM 121–240 & ... | PMC2717074_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{Median duration} \\
\hline
No stratification & 42 (36–48) \\
\hline
Stratification \\
\hline
Primiparous & 39 (35–48) \\
\hline
Multiparous & 48 (42–48) \\
\hline
Lactation stage at lesion onset \\
\hline
DIM* 0–120 & 42 (39–56) \\... | PMC2717074_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Pre-contrast} & \textbf{Post-contrast} & \textbf{CER*} \\
\hline
Triolein Group (n = 12) & 504 (56.5) & 1793 (229.9) & 2.61 (0.73) \\
\hline
Saline Group (n = 18) & 582 (519.1) & 712 (704.0) & 0.22 (0.37) \\
\hline
\end{tabular... | PMC2717075_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{HPVgenotype} & \textbf{Primer sequences} & \textbf{Amplicon (pb)*} \\
\hline
6/11 & TGC AAG AAT GCA CTG ACC AC TGC ATG TTG TCC AGC AGT GT & 334 \\
\hline
16 & CAC AGT TAT GCA CAG AGC TGC CAT ATA TTC ATG CAA TGT AGG TGT A & 457 \\
\h... | PMC2717078_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\multicolumn{4}{c|}{\textbf{HPV-DNA}} \\
\hline
\textbf{Type n = 18} & \textbf{Carcinogenic risk} & \textbf{Frequency n = 82} & \textbf{\%} \\
\hline
6/11 & LR & 17 & 20.7 \\
\hline
42 & LR & 13 & 15.9 \\
\hline
16 & HR & 13 & 15.9 \\
\hl... | PMC2717078_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Cohort (n = 223)} & \textbf{Characteristic} & \textbf{aSer/Ser (n = 170)} & \textbf{aSer/Leu (n = 43)} & \textbf{aLeu/Leu (n = 10)} \\
\hline
No (\%) of patients & Co-existing diseases \\
\hline
103 (46.2) & Arterial hypertensio... | PMC2717080_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& & & \multicolumn{3}{c|}{\textbf{\textbf{No.} of individuals with genotype (\%)}} \\
\hline
\textbf{Population and disease} & \textbf{No.} & \textbf{Variant Allele Frequency (\%)} & \textbf{Ser/Ser} & \textbf{Ser/Leu} & \textbf{... | PMC2717080_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{6}{c|}{\textbf{Particle size (nm) ($\pm$ SD)}} \\
\hline
\textbf{Samples} & \textbf{N/P = 1} & \textbf{N/P = 3} & \textbf{N/P = 5} & \textbf{N/P = 7} & \textbf{N/P = 1}0 & \textbf{N/P = 1}5 \\
\hline
PCFC-g-PEI/pDNA ... | PMC2717081_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{6}{c|}{\textbf{Zeta potential (mV) ($\pm$ SD)}} \\
\hline
\textbf{Samples} & \textbf{N/P = 1} & \textbf{N/P = 3} & \textbf{N/P = 5} & \textbf{N/P = 7} & \textbf{N/P = 1}0 & \textbf{N/P = 1}5 \\
\hline
PCFC-g-PEI/pDNA... | PMC2717081_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Mean} & \textbf{Minimum} & \textbf{Maximum} & \textbf{SD} \\
\hline
Age (year) & 27.12 & 19 & 40 & 4.84 \\
\hline
Gestational age (week) & 33.70 & 5 & 42 & 9.50 \\
\hline
HCHB1 (g/l) & 126.35 & 55 & 163 & 18.02 \\
\hline
LAHB... | PMC2717084_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Characteristics} & \textbf{\%} \\
\hline
Age group \\
\hline
15–19 & 35.8 \\
\hline
20–24 & 49.2 \\
\hline
25–29 & 12.7 \\
\hline
30 and above & 2.3 \\
\hline
Median age & 21.0 \\
\hline
Marital status \\
\hline
Unmarried & 88.3 \\
\h... | PMC2717085_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{\%} \\
\hline
Experience of kissing a girl & 57.4 \\
\hline
Experience of dating & 44.5 \\
\hline
Experience of placing hand on a girl's breast & 60.2 \\
\hline
Experience of placing hand on a girl's sex organ & 34.9 \\
\hline
Expe... | PMC2717085_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Premarital sex}} & \multicolumn{2}{c|}{\textbf{Total}} \\
\hline
& \textbf{Yes} & \textbf{No} & \textbf{\%} & \textbf{Number} \\
\hline
Age group \\
\hline
15–19 & 34.6 & 65.4 & 100.0 & 205 \\
\hline
20 a... | PMC2717085_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{\%} \\
\hline
Below 15 yrs. & 6.7 \\
\hline
15–16 & 25.0 \\
\hline
17–18 & 32.0 \\
\hline
19 or more & 36.3 \\
\hline
Total (age range 10–25 years) & 100.0 \\
\hline
N & 224 \\
\hline
\end{tabular}
\end{table} | PMC2717085_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{How many sex partners did you have (total)?} & \textbf{\%} \\
\hline
One & 45.1 \\
\hline
Two & 23.7 \\
\hline
Three and more & 31.3 \\
\hline
Average number of sex partners & 2.4 \\
\hline
SD & 2.1 \\
\hline
Ranges & 1–15 \\
\hline
T... | PMC2717085_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
& \textbf{\%} \\
\hline
Have you ever had sex with CSW? \\
\hline
Yes & 22.8 \\
\hline
No & 77.2 \\
\hline
Total & 100.0 \\
\hline
N & 224 \\
\hline
How often did you use condom with CSW? \\
\hline
Every act of sexual intercourse & 49.0 \\
\... | PMC2717085_table_5 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Model I} & \textbf{Model I}I & \textbf{Model I}II \\
\hline
Individual characteristics \\
\hline
Age group \\
\hline
15–19 & 1.0 & 1.0 & 1.0 \\
\hline
20 and above & 1.34 & 1.39 & 1.69* \\
\hline
Level of education \\
\hline
In... | PMC2717085_table_6 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{Method} & \textbf{Threshold} & \textbf{Clusters} & \textbf{Singletons} & \textbf{Max. cluster size} \\
\hline
Rice & sHYB & N/A & 305 & 0 & 2,533 \\
\hline
\multirow{6}{*}{Rice} & HYB & 1.1 & 2 & 21 & 22,459 \\
\hline
& 1.... | PMC2717093_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Clones} & \textbf{Contigs} & \textbf{Singl.} & \textbf{Q-contigs} \\
\hline
Rice FPC Standard & 22,486 & 1,918 & 860 & 8 \\
\hline
Rice Comp. sHYB & 22,486 & 2,032 & 1,156 & 6 \\
\hline
Rice Comp. HYB & 22,486 & 2,070 & 2,593... | PMC2717093_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Assembly score (\%)} & \textbf{Misplaced clones} & \textbf{Misass. contigs} & \textbf{Global ordering} \\
\hline
FPC Standard & 96.43 & 675 & 493 & 0.8252 \\
\hline
Comp. sHYB & 97.67 & 343 & 290 & 0.8496 \\
\hline
Comp. HYB ... | PMC2717093_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{MTP clones} & \textbf{Coverage (\%)} & \textbf{Overlaps (\%)} \\
\hline
FPC Standard & 2,791 & 84.89 & 84.31 \\
\hline
Comp. sHYB & 2,874 & 85.66 & 86.94 \\
\hline
Comp. HYB & 2,810 & 85.89 & 94.05 \\
\hline
Comp. RESTR & 2,792... | PMC2717093_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{TP (\%)} & \textbf{FN (\%)} & \textbf{Singl. (\%)} \\
\hline
Rice FPC Standard & 88.91 & 8.53 & 2.56 \\
\hline
Rice Comp. sHYB & 87.90 & 7.05 & 5.05 \\
\hline
Rice Comp. HYB & 83.87 & 1.90 & 14.23 \\
\hline
Rice Comp. RESTR & 8... | PMC2717093_table_4 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{c|}{\textbf{Day care attendees (N = 61)}} & \multicolumn{3}{c|}{\textbf{All participants (N = 213)}} \\
\hline
\textbf{Serotype} & \textbf{\textbf{DCC1}} & \textbf{\textbf{DCC2}} & \textbf{\textbf{DCC3}} & \textbf... | PMC2717096_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Model parameter} & \textbf{Posterior mean} & \textbf{5\% quantile} & 9\textbf{5\% quantile} \\
\hline
κ Community acquisition rate (per month) & 0.0059 & 0.0043 & 0.0077 \\
\hline
βfam Family transmission rate (per month) & 0.36 &... | PMC2717096_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Vaginal (V19I, V12I, V11I)}} & \multicolumn{2}{c|}{\textbf{Ectocervical (3ECI)}} & \multicolumn{2}{c|}{\textbf{Endocervical (sA2EN)}} \\
\hline
& \textbf{\textbf{\textbf{MOI 10}}} & \textbf{\textbf{\t... | PMC2717097_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Primer combinations used} & \textbf{Size of the expected PCR product [bp]} & \textbf{PCR product obtained} \\
\hline
GI1 & GI1–1/GI1–2 & 1,331 & - \\
\hline
GI1* & GI1–2/GI1–3 & 677 & + \\
\hline
GI2 & GI2-1/GI2–2 & 624 & + \\
... | PMC2717098_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Designation} & \textbf{DNA-Sequence} \\
\hline
GI1-1 & 5'-TAC GGA CCT TCT CGG CGG-3' \\
\hline
GI1–2 & 5'-GAC CCA AGG CAA GAC GCT G-3' \\
\hline
GI1–3 & 5'-ATT ACC CGC ATT CCC TTG TTG-3' \\
\hline
GI2-1 & 5'-TCG TTG ACC TCG CTC CTC CA... | PMC2717098_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{MIC Mutant} & \textbf{Design Score} & \textbf{SEC Binding} \\
\hline
N69Q_Q108L_Q120I_K154S_T155D & -8.1 & + \\
\hline
N69Q_Q120I_K154S_T155D_Y157L & -7.1 & - \\
\hline
N69Q_D72F_K154S_T155D & -7.1 & + \\
\hline
N69Q_Q120I_K154S_T15... | PMC2717102_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Origin} & \textbf{Sequence} & \textbf{Reference} \\
\hline
Plasma proteins \\
\hline
Complement factor C3 & LGEACKKVFLDCCNYITELRRQHARAS & [13,14] \\
\hline
High molecular weight kininogen & HKHGHGHGKHKNKGKKNGKH & [15] \\
\hline
Fibr... | PMC2717103_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Causes} & \textbf{number} & \textbf{\%} \\
\hline
$\geq$ BMI** 30 kg/m2 & 3 & 6.8 \\
\hline
PEGs suture-free technique & 6 & 13.6 \\
\hline
PEGs could not be performed \\
\hline
Non dilatable stenosis & 26 & 59.1 \\
\hline
Neoplasia... | PMC2717113_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Variable} & \textbf{number} & \textbf{\%} \\
\hline
Gender \\
\hline
Male & 354 & 81.4 \\
\hline
Female & 81 & 18.6 \\
\hline
Baseline disease \\
\hline
Head/Neck neoplasia & 346 & 79.5 \\
\hline
Esophagus neoplasia & 74 & 17.0 \\
\... | PMC2717113_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Author [ref]} & \textbf{Year} & \textbf{Gastropexy} & \textbf{Antibiotics} & \textbf{N} & Infection (\textbf{N}) & \textbf{Infection (\%)} \\
\hline
Russell TR [12] & 1984 & \textbf{N}o & \textbf{N}/A & 28 & 1 & 3.6 \\
\hlin... | PMC2717113_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Characteristics} & \textbf{Population*} & \textbf{Episodes} & \textbf{Period prevalence (\%) [95\% CI]} \\
\hline
& 1,004 & 170 & 16.9 [14.7–19.4] \\
\hline
Gender \\
\hline
Female & 524 & 89 & 17 [13.9–20.5] \\
\hline
Male & 480... | PMC2717114_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Alabama} & \textbf{0.309} & \textbf{Montana} & \textbf{0.277} \\
\hline
Alaska & 0.226 & North Carolina & 0.31 \\
\hline
Arkansas & 0.362 & North Dakota & 0.217 \\
\hline
Arizona & 0.304 & Nebraska & 0.209 \\
\hline
California & 0... | PMC2717116_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Prostasin} & \textbf{Healthy} & \textbf{Cases} \\
\hline
& & Adenomas1 & & Carcinomas \\
\hline
& & Mild/moderate dysplasia & Severe dysplasia \\
\hline
& (n = 23) & (n = 93) & (n = 13) & (n = 116) \\
\hline
Men & 9 & 68 &... | PMC2717118_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{mRNA level in normal tissue Mean (SD)} & \textbf{\textbf{Pa}} & \textbf{mRNA level in adenomas/ carcinomas Mean (SD)} & \textbf{\textbf{Pa}} & \textbf{Pb} \\
\hline
Prostasin \\
\hline
Healthy individuals &... | PMC2717118_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|}
\hline
\textbf{Probeset typea} & \textbf{Number of probesets} \\
\hline
Total number of probesets & 61115 \\
\hline
Cross-hybridizing (_s_at,_x_at,_a_at) & 12704 \\
\hline
Ambiguous orientation (A1) & 10643 \\
\hline
Members of 5' (i.e. "prune") set... | PMC2717122_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{Forward primer} & \textbf{Reverse primer} & \textbf{Product size (bp)} \\
\hline
ELF1 & CAGATTGGCAACGGCTACG & CGGACAGCAAAACGACCAAG & 227 \\
\hline
GAPDH & TTCAACATCATTCCAAGCAGCA & CGTAACCCAAAATGCCCTTG & 220 \\
\hli... | PMC2717122_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Probeset} & \textbf{Forward primer} & \textbf{Reverse primer} & \textbf{Product size (bp)} \\
\hline
Barley1 \\
\hline
Contig8230 & TACATGCTCTTGTTTGGTGCTACTG & AAGGTAAGTAGGCAGCAGTGAAGGT & 204 \\
\hline
Contig6943 & GGGGAAATCCCAGGT... | PMC2717122_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& & & \textbf{\% Frequency} & & \multicolumn{2}{c|}{\textbf{Fisher’s exact}} \\
\hline
\textbf{Genes} & \textbf{Method} & \textbf{PT} & \textbf{PN} & \textbf{NN} & \textbf{ap value} & \textbf{bp value} \\
\hline
B4GALT1 & C-MSP ... | PMC2717211_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{c|}{\textbf{SFRP1}} & \multicolumn{3}{c|}{\textbf{B4GALT1}} & \multicolumn{3}{c|}{\textbf{OSMR}} & \multicolumn{3}{c|}{\textbf{SFRP1}+\textbf{OSMR}d} \\
\hline
\textbf{Clinical features} & \textbf{\tex... | PMC2717211_table_1 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Clinical features} & \textbf{(+) M} & \textbf{\%} & \textbf{eP value} & \textbf{fP value} \\
\hline
Controlsa & 4/81 & 5 \\
\hline
CRCb \\
\hline
Total & 26/69 & 38 & ,0.001* \\
\hline
Stagec I & 2/18 & 11 & 0.299 \\
\hline
II &... | PMC2717211_table_2 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|}
\hline
\textbf{Tissues} & \textbf{Expression} & \textbf{Tumor Grade} \\
\hline
Colon Cancer \\
\hline
1 & - & III \\
\hline
2 & - & III \\
\hline
3 & - & III \\
\hline
4 & + & III \\
\hline
5 & + & II \\
\hline
6 & - & II \\
\hline
7 & - & II \\
\... | PMC2717211_table_3 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Among Total Sample}} & \multicolumn{3}{c|}{\textbf{Among Ideators}} \\
\hline
\textbf{DSM-IV Disorders} & \textbf{Ideation} & \textbf{Attempt} & \textbf{Plan} & \textbf{Plan}ned \textbf{Attempt} & Unplan... | PMC2717212_table_0 | |
\begin{table}
\centering
\label{tab:tablelabel}
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{c|}{\textbf{Among Total Sample}} & \multicolumn{3}{c|}{\textbf{Among Ideators}} \\
\hline
\textbf{DSM-IV Disorders} & \textbf{Ideation} & \textbf{Attempt} & \textbf{Plan} & \textbf{Plan}ned \textbf{Attempt} & Unplan... | PMC2717212_table_1 |
End of preview. Expand in Data Studio
README.md exists but content is empty.
- Downloads last month
- 8