sequence string | accession string | virus_name string | family string | subfamily string | genus string | host string | standardized_host string | host_category string | host_order string | isolation_source string | isolation_date string | strain_name string | location string | standardized_location string | genome_length int32 | gc_content float32 | cpg_oe_ratio float32 | latency_site string | cell_tropism_breadth string | gemini_annotated bool |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
ACCTTCCCCCCCCCTACTAATAATATGCATATCACATGCCTATCAAATGATGCCTTTTCCAATGAGCCCTGTATAAACCATCCTCAATTATACTCATTGGCCGGATGAATGCAATCAACAAAATTTTCAATATCTATTTAGCACACCATATTTATTATGTGCCTTTCTAACCAACAATGACAAAGCCACTATTTAACAAACACGTACTTTGCTTCAAATGAAATTACGTTTTATACACCACATATATGCTTTATTAACAATTTAAAATAAAGTATAAGATGCAATAATTTCGTTGTAACGTGTAAAATCTGTTTTTACCT... | PX651398.1 | Proboscivirus elephantidbeta1 | Orthoherpesviridae | Betaherpesvirinae | Proboscivirus | non-human | Elephas maximus | Mammal | Proboscidea | heart tissue from elephant that died of hemorrhagic disease | 14-Sep-2023 | EEHV1B_AUP_01_2023 | Australia | Australia | 178,371 | 0.420887 | 1.01159 | monocyte / hematopoietic progenitor cell (presumed) | broad | false |
"GGCCCAGCCCCCGCGCGGGGGGGCGCAGAGAAAAAAAAAATTTTTTTCGCGCGGCGCGTGCATTGCGGCGGGCGGGGGCGGGGTGGGGGATGGGCGCGG(...TRUNCATED) | PX620076.1 | bovine alphaherpesvirus 1 | Orthoherpesviridae | Alphaherpesvirinae | Varicellovirus | non-human | Bos taurus | Mammal | Artiodactyla | 2023 | PVNRTGVU/VBT/2023/0761 | India | India | 134,896 | 0.724217 | 1.195372 | sensory ganglion neuron (presumed) | narrow | false | |
"GGCCCAGCCCCCGCGCGGGGGGCGCGGAGAAAAAAAAAATTTTTTCCGCGCGGCGCGTGCATTGCGGCGGGCGGGGGCGGGGTGGGGGATGGGCGCGGA(...TRUNCATED) | PX625471.1 | bovine alphaherpesvirus 1 | Orthoherpesviridae | Alphaherpesvirinae | Varicellovirus | non-human | Bos taurus | Mammal | Artiodactyla | nasal swab | 2022 | BoHV-1.2b/Bovine/CHN/SZ01/2022 | China: SUIZHOU | China | 135,805 | 0.727109 | 1.196234 | sensory ganglion neuron (presumed) | narrow | false |
"GGCCAGGCTCTCTCTCGGGCGCGGGCCCGTGAAAAAAATTTTTCGGCCTCGCGACGGCCTCGAAGAAAACCGTAGAGGGGAGTGGGGGATGGGATTTTT(...TRUNCATED) | PQ630629.1 | Equid alphaherpesvirus 1 | Orthoherpesviridae | Alphaherpesvirinae | Varicellovirus | non-human | Equus caballus | Mammal | Perissodactyla | fetal tissue | 14-Feb-2024 | KY24UT26 | USA | USA | 149,562 | 0.565485 | 0.997155 | trigeminal ganglion neuron / CD8+ T lymphocyte | broad | false |
"AAATGGCGGCTAGTCCCAAGATGTCGGGTCCGGCCCCGCAAAATGGCAGCCAGTCCCAAGATGTCGGCACCGGCCCCGCAAAATGGCGGCTAGTCCCAA(...TRUNCATED) | PV231823.1 | Ovine gammaherpesvirus 2 | Orthoherpesviridae | Gammaherpesvirinae | Macavirus | non-human | Unknown | Unknown | Unknown | Jan-2024 | TW01 | Taiwan | Taiwan | 131,178 | 0.523891 | 0.576178 | B lymphocyte (presumed) | broad | false | |
"AGATGGATACCGAGGAGGCGCGACCACGTGAAACTTCCGTGGGCCTCATGACGAGCAGAAAAGTGTAAAGTGTAAGCAGACAGGAGCGGAAGGCTAAAT(...TRUNCATED) | PP765803.1 | Equid alphaherpesvirus 4 | Orthoherpesviridae | Alphaherpesvirinae | Varicellovirus | non-human | Equus caballus | Mammal | Perissodactyla | nasal swab | May-2022 | KY22-1 | USA | USA | 144,789 | 0.50278 | 0.937709 | trigeminal ganglion neuron | narrow | false |
"GGGCCCGGCGCCCGCGCGGGCCCACTCCCTGCCCTTAGGGCGCTCCGCCCAGGCCTCCTCCCCCTCCGGCCCTTTATCTAGGTGTTTCACCCTCTCGCC(...TRUNCATED) | PV541150.1 | Equid alphaherpesvirus 3 | Orthoherpesviridae | Alphaherpesvirinae | Varicellovirus | non-human | Equus caballus | Mammal | Perissodactyla | oral swab | Feb-2025 | KY25-1 | USA | USA | 151,555 | 0.680921 | 1.100519 | sensory ganglion neuron | narrow | false |
"CATTCCGGGCCGTGTGCTGGGTCCCCGGGGGGCGGGGGGGTGTTTTTTGCGGGGGGGTGAAAATTGGAGTTTCGTGTGCGGTGTGCGGTGCGGTGGGAC(...TRUNCATED) | LC846339.1 | Human betaherpesvirus 5 | Orthoherpesviridae | Betaherpesvirinae | Cytomegalovirus | human | Homo sapiens | Mammal | Primates | cerebrospinal fluid | 2009-10-13 | 20026 | Japan:Fukushima | Japan | 235,700 | 0.574485 | 1.190191 | monocyte / CD34+ hematopoietic progenitor cell | broad | false |
"CCATTCCGGGCCGTGTGCTGGGTCCCCGAGGGTCGGGGGGGTGTTTTTTGCGGGGGGGTGAAAATTGGAGTTGCGTGTGCGGTGCGGAGGACGGCGACG(...TRUNCATED) | LC846338.1 | Human betaherpesvirus 5 | Orthoherpesviridae | Betaherpesvirinae | Cytomegalovirus | human | Homo sapiens | Mammal | Primates | lymphocyte | 2011-01-25 | 22383 | Japan:Fukushima | Japan | 235,198 | 0.574805 | 1.190579 | monocyte / CD34+ hematopoietic progenitor cell | broad | false |
"GGGCGCGTCGCAGCCGGTTTTGTGGGAGTCCAGCGCGTCCATGATCCCGCCGAGGCAGGCGCCGGGCACGTACTCCTCCAGCGGGACGGGCGAGTCCCC(...TRUNCATED) | PX380308.1 | Suid alphaherpesvirus 1 | Orthoherpesviridae | Alphaherpesvirinae | Varicellovirus | non-human | Sus scrofa | Mammal | Artiodactyla | brain | 2025 | SuHV-1_IZSPB | Italy: Basilicata | Italy | 138,802 | 0.736992 | 1.127283 | trigeminal ganglion neuron / glossopharyngeal ganglion neuron | broad | false |
Herpesvirales Labeled Subset
Dataset Summary
This dataset is a curated, labeled subset of hiyata/Virus-Host-Genomes, filtered to include only complete herpesvirus genome sequences from the order Herpesvirales. Sequences from Alloherpesviridae and Malacoherpesviridae were sourced directly from NCBI and appended to extend coverage across all three families in the order.
Filtering followed the same methodology described in the original dataset's accompanying publication, excluding partial sequences, mutant strains, unverified records, BAC clones, and applying a minimum genome length threshold of 50,000 bp. Four herpesvirus-specific annotation columns not present in the source dataset were added: gc_content, cpg_oe_ratio, latency_site, and cell_tropism_breadth.
Last Updated: March 30, 2026
If you use this dataset, please cite:
@article{carbajo2026sequence,
author = {Carbajo, Alan L and Vensko, Taylor A and Pellett, Philip E},
title = {Sequence Based Virus Host Prediction: A Curated Dataset and Generalizable Framework for Training Artificial Intelligence to Identify Viruses of Humans},
journal = {Virus Evolution},
year = {2026},
pages = {veag009},
publisher = {Oxford University Press},
doi = {10.1093/ve/veag009},
url = {https://doi.org/10.1093/ve/veag009}
}
Source Dataset
This is a labeled subset of hiyata/Virus-Host-Genomes. Users interested in broader viral diversity beyond Herpesvirales should refer to the source dataset directly.
Motivation
Herpesviruses are defined by two biological properties that make them uniquely suited for sequence-level analysis: strict host specificity and lifelong latency. Every herpesvirus establishes latency in a characteristic cell type — sensory neurons, memory B cells, monocytes, or T cells depending on the virus — and this latency reservoir is the primary determinant of pathogenesis, reactivation risk, and zoonotic potential.
The order spans an extraordinary range of genomic properties. GC content ranges from 30.6% to 78.4% across this subset alone, and CpG dinucleotide suppression varies widely, reflecting co-evolutionary adaptation to different host methylation environments. These features are derivable from sequence but are not compiled alongside curated latency annotations in any existing resource. This subset was built to close that gap.
Data Fields
| Field | Type | Description |
|---|---|---|
sequence |
string | Complete genome sequence (ACGT only) |
accession |
string | NCBI accession number |
virus_name |
string | Full virus name from NCBI taxonomy |
family |
string | Orthoherpesviridae / Alloherpesviridae / Malacoherpesviridae |
subfamily |
string | Alphaherpesvirinae / Betaherpesvirinae / Gammaherpesvirinae |
genus |
string | Taxonomic genus |
host |
string | human / non-human |
standardized_host |
string | Standardized host scientific name |
host_category |
string | Mammal / Bird / Fish / Amphibian / Mollusk |
host_order |
string | Host taxonomic order (e.g. Primates, Artiodactyla, Cypriniformes) |
isolation_source |
string | Tissue or sample source from GenBank record |
isolation_date |
string | Collection date |
strain_name |
string | Strain or isolate identifier |
location |
string | Geographic location of isolation |
standardized_location |
string | Country-level standardized location |
genome_length |
int32 | Genome length in base pairs |
gc_content |
float32 | Fraction G+C (0.0–1.0) |
cpg_oe_ratio |
float32 | Observed / expected CpG dinucleotide ratio |
latency_site |
string | Cell type or tissue where latency is established |
cell_tropism_breadth |
string | broad / narrow / unknown |
gemini_annotated |
bool | Whether Gemini AI was used for annotation |
Added Columns
The following columns were added to the source data and are not present in hiyata/Virus-Host-Genomes:
| Field | Description |
|---|---|
genome_length |
Computed from the filtered sequence records |
gc_content |
Computed directly from each genome sequence |
cpg_oe_ratio |
Observed CpG dinucleotide frequency divided by expected frequency |
latency_site |
Curated from primary literature; subfamily-level defaults applied to uncharacterized strains |
cell_tropism_breadth |
Curated annotation of host cell range during lytic infection |
These annotations capture the highly host-specific biology that distinguishes Herpesvirales from other viral orders.
Key Computed Features
GC content ranges from 30.6% to 78.4%. Betaherpesvirinae (HCMV lineage) trend toward high GC (~55–60%), while Alloherpesviridae are notably AT-rich.
CpG O/E ratio ranges from 0.229 to 1.513. Low CpG O/E ratios indicate suppression relative to random, a signature of long-term adaptation to vertebrate hosts where unmethylated CpG dinucleotides trigger innate immune sensing via TLR9.
Latency site annotations were drawn from a curated lookup table covering all well-characterized herpesviruses, with subfamily-level defaults applied to less-characterized strains.
Latency Biology Notes
Latency site is the primary biologically meaningful tropism annotation in this dataset, not tissue tropism. Many herpesviruses, particularly betaherpesviruses like CMV and gammaherpesviruses like EBV, infect a broad range of cell types during lytic replication and cannot be meaningfully characterized by lytic tropism alone. The latency reservoir is the clinically and evolutionarily relevant constraint.
| Subfamily | Characteristic Latency Site |
|---|---|
| Alphaherpesvirinae | Sensory ganglion neuron (trigeminal, dorsal root, sacral) ¹ |
| Betaherpesvirinae | Monocyte / CD34+ hematopoietic progenitor ² |
| Gammaherpesvirinae | Resting memory B lymphocyte (or T lymphocyte in some) ³ |
| Alloherpesviridae | Largely unknown; possibly leukocytes in fish herpesviruses ⁴ |
| Malacoherpesviridae | Unknown; hemocytes suspected in OsHV-1 ⁵ |
¹ Gilden et al. (2001). Presence of VZV and HSV-1 DNA in Human Nodose and Celiac Ganglia. Virus Genes, 23, 145–147. https://doi.org/10.1023/A:1011883919058
² Roizman B., Knipe D.M., Whitley R.J. Herpes Simplex Viruses. In: Knipe D.M., Howley P.M., editors. Fields Virology. 6th ed. Volume 2. Lippincott Williams & Wilkins; Philadelphia, PA, USA: 2013.
³ Longnecker R., Kieff E., Cohen J.I. Epstein–Barr Virus. In: Knipe D.M., Howley P.M., editors. Fields Virology. 6th ed. Volume 2. Lippincott Williams & Wilkins; Philadelphia, PA, USA: 2013.
⁴ Reed AN, Izume S, Dolan BP, et al. Identification of B cells as a major site for cyprinid herpesvirus 3 latency. J Virol. 2014;88(16):9297–9309. https://doi.org/10.1128/JVI.00990-14
⁵ Divilov K, Wang X, Swisher AE, et al. Ostreid herpesvirus 1 latent infection and reactivation in adult Pacific oysters, Crassostrea gigas. Virus Res. 2024;339:199245. https://doi.org/10.1016/j.virusres.2023.199245
Filtering Methodology
Sequences were filtered from hiyata/Virus-Host-Genomes using the same criteria described in the accompanying publication: partial sequences, mutant strains, unverified records, and BAC clones were excluded, and a minimum genome length threshold of 50,000 bp was applied to remove fragments. Only records classified within the order Herpesvirales were retained.
Limitations
- Latency site annotations for Alloherpesviridae and Malacoherpesviridae are based on limited literature and should be treated as provisional.
- Sampling reflects NCBI submission patterns. Well-studied human herpesviruses and economically important animal herpesviruses (koi herpesvirus, Marek's disease virus) are overrepresented relative to wildlife herpesviruses.
- Records receiving subfamily-level defaults for latency annotations should be interpreted with appropriate uncertainty, particularly for novel or poorly characterized strains.
- Downloads last month
- 43