reference stringlengths 7 774 ⌀ | aptamer_chemistry stringclasses 21
values | aptamer_name stringlengths 1 164 | target_name stringlengths 2 1.2k ⌀ | aptamer_sequence stringlengths 3 374 ⌀ | origin stringclasses 6
values | target_chemistry stringclasses 11
values | external_id stringclasses 509
values | target_sequence stringclasses 356
values | new_affinity stringlengths 3 193 ⌀ | entry_id float64 0 3.61k ⌀ | page stringlengths 44 44 ⌀ |
|---|---|---|---|---|---|---|---|---|---|---|---|
Li, Y., Liu, B., Huang, Z., & Liu, J. (2020). Engineering base-excised aptamers for highly specific recognition of adenosine. Chemical Science. doi:10.1039/d0sc00086hMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | A-10 Excised Adenosine Aptamer (ID# 8043) | Adenosine | GTATTGCGGAGGAAGGTTTTTAACCTTCGGGG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 12.7-16.9 nM | 100 | https://jc-biotechaiteam.com/AptaCom/0100-2/ |
Chiu, A.S., Sankarapani, V., Drabek, R., Jackson, G.W., Batchelor, R.H. and Kim, Y., 2018. Inhibition of vitamin C oxidation by DNA aptamers. Aptamers, 2, pp.1-20.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Aptamin C (ID# 8142) | Vitamin C | GTGGAGGCGGTGGCCAGTCTCGCGGTGGCGGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 987.9 nM | 101 | https://jc-biotechaiteam.com/AptaCom/0101-2/ |
Riccardi C, D’Aria F, Digilio FA, Carillo MR, Amato J, Fasano D, De Rosa L, Paladino S, Melone MAB, Montesarchio D, Giancola C. Fighting the Huntington’s Disease with a G-Quadruplex-Forming Aptamer Specifically Binding to Mutant Huntingtin Protein: Biophysical Characterization, In Vitro and In Vivo Studies. Internation... | DNA | MS3 (ID# 8203) | Huntingtin | GGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGAGGGA | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 102 | https://jc-biotechaiteam.com/AptaCom/0102-2/ |
Chen and Gold. "Selection of High-Affinity RNA Ligands to Reverse Transcriptase: Inhibition of cDNA Synthesis and RNase H Activity." Journal of Biochemistry, 33(1994): 8746-8756.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008):... | RNA | Moloney Murine Leukemia Virus (ID# 7575) | Moloney Murine Leukemia Virus (M-MLV) RT | UUACCACGCGCUCUUAACUGCUAGCGCCAUGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 6.9 nM | 103 | https://jc-biotechaiteam.com/AptaCom/0103-2/ |
Yunn N, Koh A, Han S, Lim JH, Park S, et al. (2015) Agonistic Aptamer to the Insulin Receptor Leads to Biased Signaling and Functional Selectivity Through Allosteric Modulation. Nucleic Acids Research 1. doi:10.1093/narlgkv767Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to ... | DNA | IR-A48 (ID# 7957) | Insulin Receptor | CGCCTGGGAAGACAACCCAGGCAGGCG | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.5 nM | 104 | https://jc-biotechaiteam.com/AptaCom/0104-2/ |
Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | ex-50.T (ID# 8143) | Breast cancer exosomes | UGUGGCAGUUAAGAAUAGAUCUUCGCUGCGAUU | https://www.aptagen.com/apta-index/ | Other | null | null | 0.8 nM | 105 | https://jc-biotechaiteam.com/AptaCom/0105-2/ |
Macdonald, J., Denoyer, D., Henri, J., Jamieson, A., Burvenich, I. J., Pouliot, N., & Shigdar, S. (2020). Bifunctional aptamer–doxorubicin conjugate crosses the blood–brain barrier and selectively delivers its payload to EpCAM-positive tumor cells. Nucleic acid therapeutics, 30(2), 117-128.Miyakawa, Shin, et al. "Struc... | DNA | TEPP (ID# 8144) | bEnd.3 and MDA-MB-231 | GCGCGGTACCGCGCTAACGGAGGTTGCGTCCGT | https://www.aptagen.com/apta-index/ | Cells | null | null | 110-85.6 nM | 106 | https://jc-biotechaiteam.com/AptaCom/0106-2/ |
Macdonald, J., Denoyer, D., Henri, J., Jamieson, A., Burvenich, I. J. G., Pouliot, N., and S. Shigar. 2020. Bifunctional Aptamer–Doxorubicin Conjugate Crosses the Blood–Brain Barrier and Selectively Delivers Its Payload to EpCAM-Positive Tumor Cells. Nucleic Acid Therapeutics 30:2: 117-128. DOI: 10.1089/nat.2019.0807Mi... | DNA | TEPP (ID# 8175) | Tfr (transferrin receptor) / EpCAM (epithelial cell adhesion molecule) | GCGCGGTACCGCGCTAACGGAGGTTGCGTCCGT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | Tfr: 110\u2009±\u200922.0, EpCAM: 85.6\u2009±\u200928.5 nM | 107 | https://jc-biotechaiteam.com/AptaCom/0107-2/ |
Tang, J., et al. "In vitro selection of DNA aptamer against abrin toxin and aptamer-based abrin direct detection." Biosensors and Bioelectronics, 22 (2007): 2456-2463.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Abrin Toxin (TA6) (ID# 7495) | Abrin Toxin | ATCCTGTGAGGAATGCTCATGCATAGCAAGGGCT | https://www.aptagen.com/apta-index/ | Protein | null | null | ~28 nM | 108 | https://jc-biotechaiteam.com/AptaCom/0108-2/ |
Jellinek, D., et al. "High-affinity RNA ligands to basic fibroblast growth factor inhibit receptor binding." Proceedings of the National Academy of Sciences of the United States of America, 90(1993): 11227ƒ??11231.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immun... | RNA | Basic Fibroblast Growth Factor (26A-t) (ID# 7540) | Basic Fibroblast Growth Factor (bFGF) | GGUGAAGGCAACGUAUAGGCAAGCACACUUCACC | https://www.aptagen.com/apta-index/ | Protein | null | null | 190 pM | 109 | https://jc-biotechaiteam.com/AptaCom/0109-2/ |
Kim and Jeong. "In Vitro Selection of RNA Aptamer and Specific Targeting of ErbB2 in Breast Cancer Cells." Oligonucleotides, doi:10.1089/oli.2011.028.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | ErbB2 (SE15-8) (ID# 7597) | ErbB2 in Breast Cancer Cells | AGCCGCGAGGGGAGGGAUAGGGUAGGGCGCGGCU | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.49 nM | 110 | https://jc-biotechaiteam.com/AptaCom/0110-2/ |
Qin, L., et al.(2009). "The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis." Clin Chem Lab Med, 47(4), 405-411. doi: 10.1515/CCLM.2009.097Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14... | DNA | M64CA (ID# 7668) | MPT64 Protein | TTCGGGAATGATTATCAAATTTATGCCCTCTGAT | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 111 | https://jc-biotechaiteam.com/AptaCom/0111-2/ |
Laura Cerchia, Carla L Esposito, Simona Camorani, Anna Rienzo, Loredana Stasio, Luigi Insabato, Andrea Affuso and Vittorio de Franciscis,"Targeting Axl With an High-affinity Inhibitory Aptamer". Molecular Therapy vol.20 no.12, 2291-2303, Dec2012.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecifici... | RNA | GL21.T (ID# 7907) | Axl tyrosine kinase receptor | AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 12 nM | 112 | https://jc-biotechaiteam.com/AptaCom/0112-2/ |
Gu, Chunmei et al. “Label-free fluorescence detection of melamine with a truncated aptamer.” The Analyst vol. 141,14 (2016): 4511-7. doi:10.1039/c6an00537cMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Rd29C33-T7 (ID# 8070) | Melamine | GCACACCGATGGCGGTCCTGTTTAGGGGGTGTGC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 0.92-0.98 nM | 113 | https://jc-biotechaiteam.com/AptaCom/0113-2/ |
Development of an aptamer beacon for detection of interferon-gamma. Tuleuova, et. al (2010)https://pubmed.ncbi.nlm.nih.gov/20121141/Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | IFN-γ-binding aptamer (ID# 8230) | IFN-γ | GGGGTTGGTTGTGTTGGGTGTTGTGTCCAACCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 3 nM | 114 | https://jc-biotechaiteam.com/AptaCom/0114-2/ |
Lorsch and Szostak. "In vitro selection of RNA aptamers specific for cyanocobalamin." Biochemistry, 33 (1994): 973-982.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Cyanocobalamin (35-mer) (ID# 7513) | Cyanocobalamin | CCGGUGCGCAUAACCACCUCAGUGCGAGCAAGGAA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 88 nM | 115 | https://jc-biotechaiteam.com/AptaCom/0115-2/ |
Qin, L., et al.(2009). "The selection and application of ssDNA aptamers against MPT64 protein in Mycobacterium tuberculosis." Clin Chem Lab Med, 47(4), 405-411. doi: 10.1515/CCLM.2009.097Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14... | DNA | M64RA (ID# 7669) | MPT64 Protein | TGGGAGCTGATGTCGCATGGGTTTTGATCACATGA | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 116 | https://jc-biotechaiteam.com/AptaCom/0116-2/ |
Mori, Y. (2012). Inhibitory RNA aptamer against sp6 RNA polymerase. Biochemical and Biophysical Resarch Communications, 420 (2012), 440-443.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | SP6 RNA polymerase (S05) (ID# 7673) | SP6 RNA Polymerase | UUGCUUGGAAUGCGUUAUAGUCUCUUAGGUGUGUA | https://www.aptagen.com/apta-index/ | Protein | null | null | 9.5 nM | 117 | https://jc-biotechaiteam.com/AptaCom/0117-2/ |
Sung HJ, Choi S, Lee JW, Ok CY, Bae YS, Kim YH, Lee W, Heo K, Kim IH. Inhibition of human neutrophil activity by an RNA aptamer bound to interleukin-8. Biomaterials. 2014 Jan;35(1):578-89. doi: 10.1016/j.biomaterials.2013.09.107. Epub 2013 Oct 13.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecifici... | 2'-F-RNA | Interleukin 8 (8A-35) (ID# 7970) | Interleukin-8 (CXCL-8) | GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.72 pM | 118 | https://jc-biotechaiteam.com/AptaCom/0118-2/ |
Zhu, YF., Wang, YS., Zhou, B. et al. Anal Bioanal Chem (2017). doi:10.1007/s00216-017-0436-1.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Cd(II)-specific aptamer (CAP) (ID# 7979) | Cadmium (II) | GGGGACTGTTGTGGTATTATTTTTGGTTGTGCAGT | https://www.aptagen.com/apta-index/ | Other | null | null | 2.15 nM | 119 | https://jc-biotechaiteam.com/AptaCom/0119-2/ |
Cheung, Y.-W., Röthlisberger, P., Mechaly, A. E., Weber, P., Levi-Acobas, F., Lo, Y., … Tanner, J. A. (2020). Evolution of abiotic cubane chemistries in a nucleic acid aptamer allows selective recognition of a malaria biomarker. Proceedings of the National Academy of Sciences, 202003267. doi:10.1073/pnas.2003267117Miya... | DNA | 1501s malaria aptamer (ID# 8025) | PvLDH (Malaria) | GGTATAGACCCCTGAGTCCTACCGAGGGCACGGCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 670 nM | 120 | https://jc-biotechaiteam.com/AptaCom/0120-2/ |
Li, L., Wan, J., Wen, X., Guo, Q., Jiang, H., Wang, J., … Wang, K. (2021). Identification of a New DNA Aptamer by Tissue-SELEX for Cancer Recognition and Imaging. Analytical Chemistry, 93(19), 7369–7377. doi:10.1021/acs.analchem.1c01445Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA a... | DNA | SW1A (ID# 8183) | SMMC-7721 cells (liver cancer) | AGGCCCGCCGGGTGGGTGGGGGGGTTTGCGGGCCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 123.62 ± 17.53 nM | 121 | https://jc-biotechaiteam.com/AptaCom/0121-2/ |
Gelinas, A. D., Tan, T. K., Liu, S., Jaramillo, J. G., Chadwick, J., Harding, A. C., Zhang, C., Ream, B. E., Chase, C. N., Otis, M. R., Lee, T., Schneider, D. J., James, W. S., & Janjic, N. (2023). Broadly neutralizing aptamers to SARS-COV-2: A diverse panel of modified DNA antiviral agents. Molecular Therapy - Nucleic... | DNA | SL1108_18 (ID# 8242) | RBD of SARS-COV-2 Spike protein (monomer or trimer) | TCGGAATGAATGTCTGCCTTGCACTGGTGCGGTCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.4-0.6 nM | 122 | https://jc-biotechaiteam.com/AptaCom/0122-2/ |
Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1... | DNA | Plasmodium vivax lactate dehydrogenase (pL1) (ID# 7693) | Plasmodium vivax lactate dehydrogenase (PvLDH) | GTTCGATTGGATTGTGCCGGAAGTGCTGGCTCGAAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 16.8 nM | 123 | https://jc-biotechaiteam.com/AptaCom/0123-2/ |
Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1... | DNA | Plasmodium falciparum lactate dehydrogenase (pL1) (ID# 7694) | Plasmodium falciparum lactate dehydrogenase (PfLDH) | GTTCGATTGGATTGTGCCGGAAGTGCTGGCTCGAAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 38.7 nM | 124 | https://jc-biotechaiteam.com/AptaCom/0124-2/ |
S Gomes et al. A 99mTc-MAG3-aptamer for imaging human tumours associated with high level of matrix metalloproteinase-9. Bioconjugate Chem. (2012). Accepted for print. DOI: 10.1021/bc300146c.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal... | Chimeric | Human Matrix Metalloprotease 9 (hMMP-9) (F3Bomf) (ID# 7743) | Human matrix metalloprotease 9 (hMMP-9) | UGCCCUGCCCUCACCCGUUAGCCUGAGCGCCCCGCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 20 nM | 125 | https://jc-biotechaiteam.com/AptaCom/0125-2/ |
J Zhao et al. High-Resolution and Universal Visualization of Latent Fingerprints Based on Aptamer-Functionalized Core-Shell Nanoparticles with Embedded SERS Reporters. ACS Appl. Mater. Interfaces 8(2016): 14389-14395.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human imm... | DNA | Lysozyme Aptamer (ID# 7975) | Lysozyme | TTTTTTATCAGGGCTAAAGAGTGCAGAGTTACTTAG | https://www.aptagen.com/apta-index/ | Protein | null | null | N/A µM | 126 | https://jc-biotechaiteam.com/AptaCom/0126-2/ |
Ko, J. et al. "Identification of a structural motif of 23S rRNA interacting with 5S rRNA." FEBS Letters, 508 (2001): 300-304.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | E. Coli 5S RNA (Helix 89 RNA) (ID# 7516) | E. Coli 5S RNA | GGUGAUACCGCCCAAGAGUUCAUAUCGACGGCGGUGU | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 3 µM | 127 | https://jc-biotechaiteam.com/AptaCom/0127-2/ |
Wochner et al. "A DNA aptamer with high affinity and specificity for therapeutic anthracyclines." Analytical Biochemistry, 373(2008): 34-42.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Daunomycin (10.10) (ID# 7586) | Daunomycin | ACCATCTGTGTAAGGGGTAAGGGGTGGGGGTACGTCT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 272 nM | 128 | https://jc-biotechaiteam.com/AptaCom/0128-2/ |
Brunette et al. "RNA Aptamer Therapy for Vaso-Occlusion in Sickle Cell Disease." Nucleic Acids Therapeutics, 21(2011): 275-283. Mi et al. "Targeted inhibition of av??3 integrin with an RNA aptamer impairs endothelial cell growth and survival." Biochemical and Biophysical Research Communications, 338(2005): 956-963.M... | RNA | Endothelial Integrin Alpha-V Beta-3 (Clone 17.16) (ID# 7613) | Alpha-V Beta-3 | UUCAACGCUGUGAAGGGCUUAUACGAGCGGAUUACCC | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 129 | https://jc-biotechaiteam.com/AptaCom/0129-2/ |
R Mallikaratchy et al. "A multivalent DNA aptamer specific for the B-cell receptor on human lymphoma and leukemia." Nucleic Acids Res. 39(2011): 2458-2469.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | Chimeric | Membrane-Bound IgM (TD05.17) (ID# 7717) | Membrane-bound IgM (mIgM )/ B-cell receptor (BCR )/ Leukemia / Lymphoma | AGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 43 nM | 130 | https://jc-biotechaiteam.com/AptaCom/0130-2/ |
R Yamamoto et al. A novel RNA motif that binds efficiently and specifically to the Tat protein of HIV and inhibits the trans-activation by Tat of transcription in vitro and in vivo. Genes to Cells 5(2000):371-388Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunogl... | RNA | HIV-1 Tat protein (ID# 7730) | HIV-1 Tat protein | ACGAAGCUUGAUCCCGUUUGCCGGUCGAUCGCUUCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 120 pM | 131 | https://jc-biotechaiteam.com/AptaCom/0131-2/ |
S. Marton, F. Cleto, M.A. Krieger, J. Cardoso, Isolation of an aptamer that binds specifically to E. coli, PLoS One. 11 (2016) 1–17, https://doi.org/10.1371/journal.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | PC 12-31 (ID# 8009) | Escherichia Coli (E.Coli) | CCCTCCGGGGGGGTCATCGGGATACCTGGTAAGGATA | https://www.aptagen.com/apta-index/ | Other | null | null | 87.03 nM | 132 | https://jc-biotechaiteam.com/AptaCom/0132-2/ |
Mallikaratchy, P. R., Ruggiero, A., Gardner, J. R., Kuryavyi, V., Maguire, W. F., Heaney, M. L., McDevitt, M. R., Patel, D. J., & Scheinberg, D. A. (2011). A multivalent DNA aptamer specific for the B-cell receptor on human lymphoma and leukemia. Nucleic acids research, 39(6), 2458–2469. https://doi.org/10.1093/nar/gkq... | DNA | TD05.17 (ID# 8051) | B-cells | AGGAGGATAGTTCGGTGGCTGTTCAGGGTCTCCTCCT | https://www.aptagen.com/apta-index/ | Cells | null | null | 43 nM | 133 | https://jc-biotechaiteam.com/AptaCom/0133-2/ |
Park, J. Y., Chae, J. R., Cho, Y. L., Kim, Y., Lee, D., Lee, J. K., & Kang, W. J. (2020). Targeted Therapy of Hepatocellular Carcinoma Using Gemcitabine-Incorporated GPC3 Aptamer. Pharmaceutics, 12(10), 985. doi:10.3390/pharmaceutics12100985Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of ... | DNA | G12msi (ID# 8073) | GPC3 | GTGAATTGCGTTGAATTATGTTTCAGTCATCACT | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.17 nM | 134 | https://jc-biotechaiteam.com/AptaCom/0134-2/ |
Fukunaga, Junichi et al. “A G-quadruplex-forming RNA aptamer binds to the MTG8 TAFH domain and dissociates the leukemic AML1-MTG8 fusion protein from DNA.” FEBS letters vol. 594,21 (2020): 3477-3489. doi:10.1002/1873-3468.13914Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to... | RNA | TAFapt1-S (ID# 8078) | AML1-MTG8 | GGGUUUUCGGGAUACGCGGAGGGUGGGCAAUAACCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 4.47 nM | 135 | https://jc-biotechaiteam.com/AptaCom/0135-2/ |
Rahimi F, Murakami K, Summers JL, Chen C-HB, Bitan G (2009) RNA Aptamers Generated against Oligomeric Ab40 Recognize Common Amyloid Aptatopes with Low Specificity but High Sensitivity. PLoS ONE 4(11): e7694.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobuli... | RNA | KM41 (ID# 8219) | A-beta40 | UAAUACGACUCACUAUAGGGAAUUCGAGCUCGGUACC | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 136 | https://jc-biotechaiteam.com/AptaCom/0136-2/ |
Grate, Dilara and Wilson, Charles. "Laser-mediated, site-specific inactivation of RNA transcripts." PNAS, 96 (1999): 6131-6136Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Malachite Green (MG-4) (ID# 7481) | Malchite Green | GGAUCCCGACUGGCGAGAGCCAGGUAACGAAUGGAUCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 1 µM | 137 | https://jc-biotechaiteam.com/AptaCom/0137-2/ |
Jenison et al. "High-resolution molecular discrimination by RNA." Science, 263(1994): 1425-1429.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Theophylline (mTCT8-4) (ID# 7551) | Theophylline | AGUGAUACCAGCAUCGUCUUGAUGCCCUUGGCAGCACU | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 100 nM | 138 | https://jc-biotechaiteam.com/AptaCom/0138-2/ |
Shengmin, X. (2012). Selection of dna aptamers against polychlorinated biphenyls as potential biorecognition elements for environmental analysis. Analytical Biochemistry, 423(2012), 195-201.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal... | DNA | PCB77 (II) (ID# 7689) | 3,3,4,4-tetrachlorobiphenyl (PCB77) | AAGCGCGCGAGACTACGTTTGTAGGGATACCGATGTCG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 8.32 µM | 139 | https://jc-biotechaiteam.com/AptaCom/0139-2/ |
Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1... | DNA | Plasmodium vivax lactate dehydrogenase (pL2) (ID# 7695) | Plasmodium vivax lactate dehydrogenase (PvLDH) | GAACTCATTGGCTGGAGGCGGCAGTACCGCTTGAGTTC | https://www.aptagen.com/apta-index/ | Protein | null | null | 31.7 nM | 140 | https://jc-biotechaiteam.com/AptaCom/0140-2/ |
Seonghwan, L. (2012). A highly sensitive aptasensor towards plasmodium lactate dehydrogenase for the diagnosis of malaria. Biosensors and Bioelectronics, 35(2012), 291-296.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1... | DNA | Plasmodium falciparum lactate dehydrogenase (pL2) (ID# 7696) | Plasmodium falciparum lactate dehydrogenase (PfLDH) | GAACTCATTGGCTGGAGGCGGCAGTACCGCTTGAGTTC | https://www.aptagen.com/apta-index/ | Protein | null | null | 49.6 nM | 141 | https://jc-biotechaiteam.com/AptaCom/0141-2/ |
G Biesecker et al.. "Derivation of RNA aptamer inhibitors of human complement C5." Immunopharmacology 42(1999):219-230Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | C5a (C5C6) (ID# 7718) | Human complement C5 component (C5a) | CGAUGCGGUCUCAUGCGUCGAGUGUGAGUUUACCUUCG | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 142 | https://jc-biotechaiteam.com/AptaCom/0142-2/ |
M Stojanovic, P de Prada, and D Landry. Aptamer-based folding fluorescent sensor for cocaine. J. Am. Chem. Soc. 123(2001): 4928-4931.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Cocaine (MNS-4.1) (ID# 7783) | Cocaine | GGGAGACAAGGAAAATCCTTCAATGAAGTGGGTCGACA | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 0.4 µM | 143 | https://jc-biotechaiteam.com/AptaCom/0143-2/ |
Yang KA, Barbu M, Halim M, et al. Recognition and sensing of low-epitope targets via ternary complexes with oligonucleotides and synthetic receptors. Nat Chem. 2014;6(11):1003-1008. doi:10.1038/nchem.2058Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G... | DNA | Tyrosine-Cp*Rh(III) sensor (ID# 8049) | Tyrosine | CTCTCGGGACGACGGCCCGATCTCAGAGTAGTCGTCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 2.9 nM | 144 | https://jc-biotechaiteam.com/AptaCom/0144-2/ |
Schmidt KS, Borkowski S, Kurreck J, Stephens AW,Bald R, Hecht M, et al. Application of locked nucleicacids to improve aptamer in vivo stability and targeting function. Nucleic Acids Res 2004; 32:5757-65; PMID:15509871; http://dx.doi.org/10.1093/nar/gkh862Miyakawa, Shin, et al. "Structural and molecular basis for hypers... | 2'-F-RNA | TTA1.2 (ID# 8052) | Tenascin-C (TN-C) | GGGAGGACGCGUCGCCGUAAUGGAUGUUUUGCUCCCUG | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.4 nM | 145 | https://jc-biotechaiteam.com/AptaCom/0145-2/ |
Bai, cheng, et al." Surface acoustic wave‑assisted microfluidic isolation of aptamers." Microfluidics and Nanofluidics, 26(2002): 1-10Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | R3(2) – truncated (ID# 8205) | immunoglobulin E | CGCCCGTGTTTATCCGTTTGCTCTTAGTGGCACGGGGG | https://www.aptagen.com/apta-index/ | Antibody | null | null | 22.6 nM | 146 | https://jc-biotechaiteam.com/AptaCom/0146-2/ |
Pileur, et al. "Selective inhibitory DNA aptamers of the human RNase H1." Nucleic Acids Research, 31 (2003): 5776-5788.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | RNase H1 (VI-2) (ID# 7521) | RNase H1 | CGGTCGCTCCGTGTGGCTTGGGTTGGGTGTGGCAGTGAC | https://www.aptagen.com/apta-index/ | Protein | null | null | 11 nM | 147 | https://jc-biotechaiteam.com/AptaCom/0147-2/ |
Balogh, et al. "Selection and versatile application of virus-specific aptamers." FASEB Journal, 24(2010): 4187-4195.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Apple Stem Pitting Virus of PSAH PearIsolate (ID# 7561) | Apple Stem Pitting Virus (ASPV) | AGCAAGGTTTGGTGTTGGTTGGTTGCTGGTTTTGGTTTC | https://www.aptagen.com/apta-index/ | Protein | null | null | 8 nM | 148 | https://jc-biotechaiteam.com/AptaCom/0148-2/ |
CL Esposito et al. A neutralizing RNA aptamer against EGFR causes selective apoptotic cell death. PLoS One 6(2011):e24071.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | EGFR (CL4) (ID# 7811) | EGFR - Extracellular Domain | GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 10 nM | 149 | https://jc-biotechaiteam.com/AptaCom/0149-2/ |
Muharemagic D, Zamay A, Ghobadloo SM, Evgin L, Savitskaya A, et al. (2014) Aptamer-Facilitated Protection of Oncolytic Virus from Neutralizing Antibodies. Molecular Therapy--Nucleic Acids 3, e167. doi: 10.1038/mtna.2014.19Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to huma... | DNA | Z23 Anti-Vesicular Stomatitis Virus (ID# 7958) | Vesicular Stomatitis Virus | GGGACCTATCAGGCGATGTGAAAACTCTTATACCACTGG | https://www.aptagen.com/apta-index/ | Other | null | null | EC50 =/< 80 nM | 150 | https://jc-biotechaiteam.com/AptaCom/0150-2/ |
Lee, K.H., Zeng, H. A general double library SELEX strategy for aptamer selection using unmodified nonimmobilized targets. Anal Bioanal Chem 409, 5081–5089 (2017).Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | DOX 6 (ID# 8012) | Doxycycline | GGGCGAGAACAGTGTCCCAGTCGCTAGTTTTCTCTGCCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 150 nM | 151 | https://jc-biotechaiteam.com/AptaCom/0151-2/ |
Wu, S.; Liu, Y.; Sun, H.; Zhong, M.; Dai, B.; Pan, B.; Shen, Z. An ssDNA aptamer specific for detection and purification of hexahistidine-tagged proteins. Anal. Biochem. 2020 Oct 15; 607: 113893. DOI: 10.1016/j.ab.2020.113893.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to ... | DNA | AptHis-C (ID# 8132) | Hexahistidine | TGGCAAGAGGGTGTGCTTAAGGTGGACACGGTGGCTTAG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 20.8 nM | 152 | https://jc-biotechaiteam.com/AptaCom/0152-2/ |
Shubham, S., Hoinka, J., Banerjee, S. et al. A 2′FY-RNA Motif Defines an Aptamer for Ebolavirus Secreted Protein. Sci Rep 8, 12373 (2018). https://doi.org/10.1038/s41598-018-30590-8Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008... | RNA | 39SGP1A (ID# 8151) | Ebola virus Soluble glycoprotein (sGP) | GGGCGCUCAAUUUUUUAUUGCAUUUUUCUUUGAGCGCCC | https://www.aptagen.com/apta-index/ | Protein | null | null | 30 nM | 153 | https://jc-biotechaiteam.com/AptaCom/0153-2/ |
Jalali, T., Salehi-Vaziri, M., Pouriayevali, M. H., & Gargari, S. L. M. (2021). Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens. Scientific Reports, 11(1). https://doi.org/10.1038/s41598-021-91826-8Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA apta... | RNA | Crimean-Congo Hemorrhagic fever (ID# 8245) | Nucleoprotein (NP) | CCGTAGGGTTAGGGGCGGATCGTCAGGGTGGATAAGGCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 6.62x10^-10 nM | 154 | https://jc-biotechaiteam.com/AptaCom/0154-2/ |
sassanfar and Szostak. "An RNA motif that binds ATP."Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | ATP (ATP-40-1) (ID# 7508) | ATP | GGGUUGGGAAGAAACUGUGGCACUUCGGUGCCAGCAACCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 700 nM | 155 | https://jc-biotechaiteam.com/AptaCom/0155-2/ |
Majerfeld, et al. "RNA Affnity for Molecular L-Histidine; Genetic Code Origins." Journal of Molecular Evolution, 61 (2005): 226-235.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | L-Histidine (His 945) (ID# 7520) | L-Histidine | GGCAUCGGAAAGUGGGUUGAUGUAAGUAACAGGCGAUGCC | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 12 µM | 156 | https://jc-biotechaiteam.com/AptaCom/0156-2/ |
Berglund, A., et al. "A High Affinity Binding Site for the HIV-1 Nucleocapsid Protein." Nucleic Acids Research, 25(1997):1042-1049.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | HIV-1 Nuceocapsid (ID# 7537) | HIV-1 Nuceocapsid | GGAGACAUCCCUCUUGUUGGUGGUGCCGUGUGGAUGUCUC | https://www.aptagen.com/apta-index/ | Protein | null | null | 2.3 nM | 157 | https://jc-biotechaiteam.com/AptaCom/0157-2/ |
Green, L., et al. "Inhibitory DNA Ligands to Platelet-Derived Growth Factor B-Chain." Journal of Biochemistry, 35(1996): 14413-14424.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Platelet-Derived Growth Factor (PDGF) B-chain (36t) (ID# 7545) | Platelet-Derived Growth Factor -AB (PDGF-AB) | CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.094 nM | 158 | https://jc-biotechaiteam.com/AptaCom/0158-2/ |
Balogh, et al. "Selection and versatile application of virus-specific aptamers." FASEB Journal, 24(2010): 4187-4195.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | MT32 protein of Apple Stem Pitting Virus (ASPV) (ID# 7560) | MT32 coat protein | GGGGTGGTGGGTTCTTTTTGTGGTATTGGTGTGGGGGGCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 55 nM | 159 | https://jc-biotechaiteam.com/AptaCom/0159-2/ |
Kokpinar, et al. "Aptamer-Based Downstream Processing of His-Tagged Proteins Utilizing Magnetic Beads." Biotechnology and Bioengineering, 108(2011):2371-2379.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti-His Tag (6H7) (ID# 7564) | 6X His Tag | GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 4.6 nM | 160 | https://jc-biotechaiteam.com/AptaCom/0160-2/ |
Tanaka et al. "In Vitro Selection and Characterization of DNA Aptamers Specific for Phospholamban." The Journal of Pharmacology and Experimental Therapeutics, 329(2009): 57-63.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 11... | DNA | Phospholamban (Apt-9) (ID# 7584) | Phospholamban | TTGGGGAGGGGCACTGGGCAGTGTAATTTACGAAAGCGAG | https://www.aptagen.com/apta-index/ | Protein | null | null | 20 nM | 161 | https://jc-biotechaiteam.com/AptaCom/0161-2/ |
Shengmin, X. (2012). Selection of dna aptamers against polychlorinated biphenyls as potential biorecognition elements for environmental analysis. Analytical Biochemistry, 423(2012), 195-201.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal... | DNA | PCB77 (VIII) (ID# 7690) | 3,3,4,4-tetrachlorobiphenyl (PCB77) | GGCGGGGCTACGAAGTAGTGATTTTTTCCGATGGCCCGTG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 4.02 µM | 162 | https://jc-biotechaiteam.com/AptaCom/0162-2/ |
L H Lauridsen. Rapid one-step selection method for generating nucleic acid aptamers: development of a DNA aptamer against a-bungarotoxin. PLoS ONE 7(2012): e41702.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | a-Bungarotoxin (Clone 24) (ID# 7729) | a-Bungarotoxin | GCGAGGTGTTCGAGAGTTAGGGGCGACATGACCAAACGTT | https://www.aptagen.com/apta-index/ | Protein | null | null | 7.5 µM | 163 | https://jc-biotechaiteam.com/AptaCom/0163-2/ |
Z Mi et al. RNA aptamer blockade of osteopontin inhibits growth and metastasis of MDA-MB231 breast cancer cells. Molecular Therapy 17(2009): 153-161Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | 2'-F-RNA | Osteopontin (OPN-R3) (ID# 7736) | Human Osteopontin | CGGCCACAGAAUGAAAAACCUCAUCGAUGUUGCAUAGUUG | https://www.aptagen.com/apta-index/ | Protein | null | null | 18 nM | 164 | https://jc-biotechaiteam.com/AptaCom/0164-2/ |
Green, L., et al. "Inhibitory DNA Ligands to Platelet-Derived Growth Factor B-Chain." Journal of Biochemistry, 35(1996): 14413-14424. Stejskalov?, Anna & Oliva, Nuria & J England, Frances & Almquist, Benjamin. (2019). Biologically Inspired, Cell-Selective Release of Aptamer-Trapped Growth Factors by Traction Forces. ... | DNA | Platelet-Derived Growth Factor (PDGF) B-chain (36t) (ID# 7738) | Platelet-Derived Growth Factor -BB (PDGF-BB) | CACAGGCTACGGCACGTAGAGCATCACCATGATCCTGTGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.093 nM | 165 | https://jc-biotechaiteam.com/AptaCom/0165-2/ |
D Maharemagic et al. Anti-Fab aptamers for shielding virus from neutralizing antibodies. JACS 134(2012): 17168-17177.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Antigen binding fragment of antivesicular stomatitis virus polyclonal antibodies (C5S) (ID# 7755) | Antigen binding fragment (Fab) of antivesicular stomatitis virus (VSV) rabbit polyclonal antibodies | TGTGCCAAAGAGAGTGGTGGGGGGGTGGGCGGAACTCGCG | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 166 | https://jc-biotechaiteam.com/AptaCom/0166-2/ |
Ara N, Hyodo M, Ohga N, Hida, N, Harishima H. (2012) Development of a novel DNA aptamer ligand targeting to primary cultured tumor endothelial cells by a cell-based SELEX method. PLOS one 7: e50174.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA... | DNA | Tumor Endothelial Cells (AraHH001) (ID# 7856) | Mouse and Human Tumour Endothelial Cells (mTECs and hTECs) | ACGTACCGACTTCGTATGCCAACAGCCCTTTATCCACCTC | https://www.aptagen.com/apta-index/ | Cells | null | null | 43.8 nM | 167 | https://jc-biotechaiteam.com/AptaCom/0167-2/ |
Wongphatcharachai, Manoosak, et al. "Neutralizing DNA Aptamers against Swine Influenza H3N2 Viruses." Journal of Clinical Microbiology 2013, 51(1):46.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Swine Influenza A Virus – H3N2 (HA68) (ID# 7858) | Recombinant H3 cluster IV | ACTCCGTCATCTTTAGTGGCCCCAATGTCGTTATCACCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 7.1 nM | 168 | https://jc-biotechaiteam.com/AptaCom/0168-2/ |
Gonzalez, S, et. al. "Aptamer Binding to Celiac Disease-Triggering Hydrophobic Proteins A Sensitive Gluten Detection Approach." 2014. Analytical Chemistry 86: 2733-39.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Celiac disease Aptamer (Gli4) (ID# 7895) | 33-mer (immunodominant peptide from alpha2-gliadin) | CCAGTCTCCCGTTTACCGCGCCTACACATGTCTGAATGCC | https://www.aptagen.com/apta-index/ | Peptide | null | null | 61 nM | 169 | https://jc-biotechaiteam.com/AptaCom/0169-2/ |
Tzuu-Wang Chang, Michael Blank, Pavithra Janardhanan, Bal Ram Singh, Charlene Mello, Michael Blind, Shuowei Cai, "In vitro selection of RNA aptamers that inhibit the activity of type A botulinum neurotoxin" Biochemical and Biophysical Research Communications 396 (2010) 854ƒ??860.Miyakawa, Shin, et al. "Structural and... | RNA | S132B-C22 (ID# 7920) | Botulinum Neuroxin Type A (BoNT/A) | GACAGCGUGCCUAGAAGUCCAAGCUUAAAUAACCACGCUCGACAAGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.8 nM | 170 | https://jc-biotechaiteam.com/AptaCom/0170-2/ |
Wang, Q., et al. ƒ??Sensitive point-of-care monitoring of cardiac biomarker myoglobin using aptamer and ubiquitous person glucose meter.ƒ? Biosensors and Bioelecgtronics, 64 (2015): 161-164. Wang, Q., et al. ƒ??Screening of DNA Aptamers against Myoglobin Using a Positive and Negative Selection Units Integrated Micro... | DNA | Myo40-7-27 (ID# 7954) | Myoglobin | CCCTCCTTTCCTTCGACGTAGATCTGCTGCGTTGTTCCGA | https://www.aptagen.com/apta-index/ | Protein | null | null | 4.93 nM | 171 | https://jc-biotechaiteam.com/AptaCom/0171-2/ |
Muharemagic D, Zamay A, Ghobadloo SM, Evgin L, Savitskaya A, et al. (2014) Aptamer-Facilitated Protection of Oncolytic Virus from Neutralizing Antibodies. Molecular Therapy--Nucleic Acids 3, e167. doi: 10.1038/mtna.2014.19Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to huma... | DNA | C5s Anti-Antibody (ID# 7959) | Anti-Vesicular Stomatitis Antibody | ACTAGGACGCTTGGGAGGGGGGGTGGGGTGTCCGGTCGCG | https://www.aptagen.com/apta-index/ | Antibody | null | null | n/a nM | 172 | https://jc-biotechaiteam.com/AptaCom/0172-2/ |
Hu, Lujun, et al. "Selection, Characterization and Interaction Studies of a DNA Aptamer for the Detection of Bifidobacterium bifidum" International Journal of Molecular Sciences 10.3390(2017): 833.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA ... | DNA | CCFM641-5 (ID# 7983) | Unknown Membrane Protien | TGCGTGAGCGGTAGGCCCCTACGACCCACTGTGGTTGGGC | https://www.aptagen.com/apta-index/ | Protein | null | null | 10.69 +/- 0.89 nM | 173 | https://jc-biotechaiteam.com/AptaCom/0173-2/ |
Yang, L., Gao, T., Li, W., Luo, Y., Ullah, S., Fang, X., … Pei, R. (2020). Ni-Nitrilotriacetic Acid Affinity SELEX Method for Selection of DNA Aptamers Specific to the N-Cadherin Protein. ACS Combinatorial Science. doi:10.1021/acscombsci.0c00165Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity... | DNA | NS13 (ID# 8074) | N‑Cadherin Protein | ACTTGCTCTGATGCGACAACCTTTTGCCCAGATAGTAAGT | https://www.aptagen.com/apta-index/ | Protein | null | null | 93 nM | 174 | https://jc-biotechaiteam.com/AptaCom/0174-2/ |
Kohlberger M, Wildner S, Regl C, Huber CG, Gadermaier G. Rituximab-specific DNA aptamers are able to selectively recognize heat-treated antibodies. PLoS One. 2020 Nov 5;15(11):e0241560. doi: 10.1371/journal.pone.0241560. PMID: 33151990; PMCID: PMC7644011.Miyakawa, Shin, et al. "Structural and molecular basis for hypers... | DNA | C7 (ID# 8076) | Rituximab | GGCCATTGTGGACTTCTTTGGGTAATTCAGGGGCTCGATT | https://www.aptagen.com/apta-index/ | Protein | null | null | 8.8 nM | 175 | https://jc-biotechaiteam.com/AptaCom/0175-2/ |
Kohlberger M, Wildner S, Regl C, Huber CG, Gadermaier G. Rituximab-specific DNA aptamers are able to selectively recognize heat-treated antibodies. PLoS One. 2020 Nov 5;15(11):e0241560. doi: 10.1371/journal.pone.0241560. PMID: 33151990; PMCID: PMC7644011.Miyakawa, Shin, et al. "Structural and molecular basis for hypers... | DNA | C10 (ID# 8077) | Rituximab | ACTTCGGCTAGTTAGGGGGTAGTTTAGATCGTCTCTACAT | https://www.aptagen.com/apta-index/ | Protein | null | null | 17.6 nM | 176 | https://jc-biotechaiteam.com/AptaCom/0176-2/ |
Li, X., Li, Z., & Yu, H. (2020). Selection of threose nucleic acid aptamers to block PD-1/PD-L1 interaction for cancer immunotherapy. Chemical Communications. doi:10.1039/d0cc06032aMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008... | DNA | N5 (ID# 8080) | PD-L1 | GATTGAGTAGATAGTGGTTCTGTACGTAGTGAAAGAGTGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 441 nM | 177 | https://jc-biotechaiteam.com/AptaCom/0177-2/ |
Zhu, C., Li, L., Fang, S., Zhao, Y., Zhao, L., Yang, G., & Qu, F. (2020). Selection and Characterization of an ssDNA Aptamer against Thyroglobulin. Talanta, 121690. doi:10.1016/j.talanta.2020.121690Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA... | DNA | T-2 (ID# 8098) | thyroglobulin | CGCGTGAGCGGGGAGGCGATGCCCAGGCTAACTTGACTCA | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.18 nM | 178 | https://jc-biotechaiteam.com/AptaCom/0178-2/ |
Zhang Y, Xu H, Wang X, Wang L, Liu R, Li L, Zhou H. Single‑strained DNA aptamers mask RhD antigenic epitopes on human RhD+ red blood cells to escape alloanti‑RhD immunological recognition. Mol Med Rep. 2020 Apr;21(4):1841-1848. doi: 10.3892/mmr.2020.10985. Epub 2020 Feb 12. PMID: 32319623; PMCID: PMC7057830.Miyakawa, S... | DNA | RhD antigen‑specificity 1 (ID# 8105) | RhD+ red blood cells | GGCCTGGTCTGTTAGCCGGGTAGCAGCCCCGGCACCTATT | https://www.aptagen.com/apta-index/ | Cells | null | null | 580.5±142.0 nM | 179 | https://jc-biotechaiteam.com/AptaCom/0179-2/ |
'Zhang Y, Xu H, Wang X, Wang L, Liu R, Li L, Zhou H. Single‑strained DNA aptamers mask RhD antigenic epitopes on human RhD+ red blood cells to escape alloanti‑RhD immunological recognition. Mol Med Rep. 2020 Apr;21(4):1841-1848. doi: 10.3892/mmr.2020.10985. Epub 2020 Feb 12. PMID: 32319623; PMCID: PMC7057830.Miyakawa, ... | DNA | RhD antigen‑specificity 2 (ID# 8106) | RhD+ red blood cells | GGGTAGCAGCCCCGCGGAGGGTCGGCTATAAGAACCAAGA | https://www.aptagen.com/apta-index/ | Cells | null | null | 737.7±161.8 nM | 180 | https://jc-biotechaiteam.com/AptaCom/0180-2/ |
Wu, Hangjie et al. “Rapid Detection of Helicobacter pylori by the Naked Eye Using DNA Aptamers.” ACS omega vol. 6,5 3771-3779. 21 Jan. 2021, doi:10.1021/acsomega.0c05374Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163... | DNA | HPA-2 (ID# 8107) | Helicobacter pylori | CCAGGAGGACCCTATTCTCGTGTATCGACGAGATCCAGTG | https://www.aptagen.com/apta-index/ | Other | null | null | 19.3 ± 3.2 nM | 181 | https://jc-biotechaiteam.com/AptaCom/0181-2/ |
Discovery of indole-modified aptamers for highly specific recognition of protein glycoformsAlex M. Yoshikawa, Alexandra Rangel, Trevor Feagin, Elizabeth M. Chun, Leighton Wan, Anping Li, Leonhard Moekl, Michael Eisenstein, Sharon Pitteri, H. Tom SohbioRxiv 2021.03.13.435263; doi: https://doi.org/10.1101/2021.03.13.4352... | DNA | f-4 (ID# 8155) | fetuin | CGCCAAAGCTCGATCAATAACCGAAAGAAAAGGCACATCA | https://www.aptagen.com/apta-index/ | Other | null | null | 6.2 µM | 182 | https://jc-biotechaiteam.com/AptaCom/0182-2/ |
Gong, Wenhui, et al. “Selection, Identification, and Application of Dual DNA Aptamers against Shigella Sonnei.” Analytical Methods, vol. 7, no. 8, 2015, pp. 3625–3631., https://doi.org/10.1039/c5ay00214a.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G... | DNA | Sp1 (ID# 8168) | Shigella sonnei | TTCTTCCCTTTTATTAGTCCTGTATTCCTCTACTGTTGCC | https://www.aptagen.com/apta-index/ | Cells | null | null | 5.980 nM | 183 | https://jc-biotechaiteam.com/AptaCom/0183-2/ |
Diaz-Fernandez, A, et al. "Focusing aptamer selection on the glycan structure of prostate-specific antigen: Toward a more specific detection of prostate cancer." Biosensors and Bioelectronics, 128 (2019): 83-90. doi: https://doi.org/10.1016/j.bios.2018.12.040Miyakawa, Shin, et al. "Structural and molecular basis for hy... | DNA | PSA-1 (ID# 8202) | PSA (glycosylated) | GGACGGTTGCGCTATATTTAACCAAAAGTCTGGATTAACA | https://www.aptagen.com/apta-index/ | Protein | null | null | 177 +/-65 nM | 184 | https://jc-biotechaiteam.com/AptaCom/0184-2/ |
Baumstummler, A., Lehmann, D., Janjic, N., Ochsner, U.A., 2014. Specific capture and detection of staphylococcus aureus with high-affinity modified aptamers to cell surface components. Lett. Appl. Microbiol. 59, 422–431.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human ... | DNA | 4520-8 (ID# 8211) | Staphylococcal protein A | TCGGCTTCGGGTACCTATTATCGGTTTAGCCCAGTCAGAA | https://www.aptagen.com/apta-index/ | Protein | null | null | 0.22 nM | 185 | https://jc-biotechaiteam.com/AptaCom/0185-2/ |
Lorenzo-Gomez, R, et al. Aptamers targeting a tumor-associated extracellular matrixcomponent: The human mature collagen XIa1. Analytica Chimica Acta, 1189 (2022): 339206. doi: https://doi.org/10.1016/j.aca.2021.339206Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human imm... | DNA | D1 (ID# 8214) | Human Collagen XIα1 (C-telopeptide region) | GGTTGACGGCAGTCGGCGGTATGCGCATATCGTGTTGGTA | https://www.aptagen.com/apta-index/ | Peptide | null | null | 23 +/- 5 nM | 186 | https://jc-biotechaiteam.com/AptaCom/0186-2/ |
Jun Xiang, Wen Zhang, Xiao-Fang Cai, Min Cai, Zhong-Hai Yu, Feng Yang, Wen Zhu, Xiang-Ting Li, Ting Wu, Jing-Si Zhang, Ding-Fang Cai, DNA Aptamers Targeting BACE1 Reduce Amyloid Levels and Rescue Neuronal Deficiency in Cultured Cells, Molecular Therapy - Nucleic Acids, Volume 16, 2019, Pages 302-312, ISSN 2162-2531.Miy... | DNA | BI1 (ID# 8220) | BACE1 | AGCGATACTGCGTGGCTGGAGGCGGGTAGGGCCAGAGTTC | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 187 | https://jc-biotechaiteam.com/AptaCom/0187-2/ |
Alomran, N, Raja, C, Alsolaiss, J, Casewell, NR, Zourob, M. (2022) Exploring the utility of ssDNA aptamers directed against snake venom toxins as new therapeutics for snakebite envenoming. Toxins, 14, 469. https://doi.org/10.3390/toxins14070469.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity... | DNA | Ancrod-55 (ID# 8224) | ancrod | GGACCGACCCTTTAGCATTTATGACCCTTGTCATCGGGCT | https://www.aptagen.com/apta-index/ | Protein | null | null | 3.0 nM | 188 | https://jc-biotechaiteam.com/AptaCom/0188-2/ |
Alomran, N, Raja, C, Alsolaiss, J, Casewell, NR, Zourob, M. (2022) Exploring the utility of ssDNA aptamers directed against snake venom toxins as new therapeutics for snakebite envenoming. Toxins, 14, 469. https://doi.org/10.3390/toxins14070469.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity... | DNA | Batroxobin-26 (ID# 8225) | batroxobin | TGTCTGGTATGCAAAGGACTGCTGTACTGTTAGCTTTTG | https://www.aptagen.com/apta-index/ | Protein | null | null | 4.7 nM | 189 | https://jc-biotechaiteam.com/AptaCom/0189-2/ |
https://patents.google.com/patent/CN108801989B/enMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Cytochrome c (ID# 8227) | Cytochrome c | CCGTGTCTGGGGCCGACCGGCGCATTGGGTACGTTGTTGC | https://www.aptagen.com/apta-index/ | Protein | null | null | null | 190 | https://jc-biotechaiteam.com/AptaCom/0190-2/ |
Guo, S., Lin, J., Lin, L. et al. Selecting small molecule DNA aptamers with significant conformational changes for constructing transcriptional switches and biosensors. Sci. China Chem. 66, 1529–1536 (2023). https://doi.org/10.1007/s11426-022-1540-yMiyakawa, Shin, et al. "Structural and molecular basis for hyperspecifi... | DNA | Aptamer 3-83 (ID# 8246) | Uridine 5' diphosphate | AGGGCTATGAGCCCTGCGCCGACGTCAGGCGCACCGAGAC | https://www.aptagen.com/apta-index/ | Other | null | null | 274.8 µM | 191 | https://jc-biotechaiteam.com/AptaCom/0191-2/ |
Yang, Q., et al. "DNA ligands that bind tightly and selectively to cellobiose." PNAS, 95 (1998): 5462-5467.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Cellobiose (Cel#16) (ID# 7497) | Cellobiose | GCGGGGTTGGGCGGGTGGGTTCGCTGGGCAGGGGGCGAGTG | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 600 nM | 192 | https://jc-biotechaiteam.com/AptaCom/0192-2/ |
Wochner, et al. "A DNA aptamer with high affinity and specificity for therapeutic anthracyclines." Analytical Biochemistry, 373(2008): 34-42.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Daunomycin (10.10v) (ID# 7558) | Daunomycin | ACCATCTGTGTAAGGGGTAAGGGGTGGGGGTGGGTACGTCT | https://www.aptagen.com/apta-index/ | Small Organic | null | null | 272 nM | 193 | https://jc-biotechaiteam.com/AptaCom/0193-2/ |
Hirao et al. "RNA Aptamers That Bind to and Inhibit the Ribosome-inactivating Protein, Pepocin." The Journal of Biological Chemistry, 275(2000): 4943-4948.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | RNA | Pepocin (9-41U22) (ID# 7572) | Pepocin | GGGAGUCUGAAGUCGGACUUGUUAUCAAUUCACUUCAGACU | https://www.aptagen.com/apta-index/ | Protein | null | null | 18 nM | 194 | https://jc-biotechaiteam.com/AptaCom/0194-2/ |
D Michalowski et al. Novel bimodular DNA aptamers with guanosine quadruplexes inhibit phylogenetically diverse HIV-1 reverse transcriptases. Nucleic Acid Res. 36(2008): 7124-7135. Y-T Lai and J DeStefano. DNA aptamers to human immunodeficiency virus reverse transcriptase selected by a primer-free SELEX method: chara... | DNA | HIV-1 Reverse Transcriptase (R1T) (ID# 7782) | HIV-1 RT | CGCCTGATTAGCGATACTCAGGCGTTGGGTGGGTGGGTGGG | https://www.aptagen.com/apta-index/ | Protein | null | null | 1.1 nM | 195 | https://jc-biotechaiteam.com/AptaCom/0195-2/ |
Sequence: Shangguan et al. "Optimization and Modifications of Aptamers Selected from Live Cancer Cell Lines." Chem. Biochem., 8, (2007): 603-6. Doxorubicin conjugation: Y-F Huang et al. Molecular assembly of an aptamer-drug conjugate for targeted drug delivery to tumor cells. Chembiochem. 10(2009):862-868.Miyaka... | DNA | CCRF-CEM (sgc8c) (ID# 7813) | Acute lymphoblastic leukemia (CCRF-CEM) | ATCTAACTGCTGCGCCGCCGGGAAAATACTGTACGGTTAGA | https://www.aptagen.com/apta-index/ | Cells | null | null | 0.78 nM | 196 | https://jc-biotechaiteam.com/AptaCom/0196-2/ |
Jimenez et al. Generation of Lung Adenocarcinoma DNA Aptamers for Cancer Studies (PLOSone)Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | Anti Lung Carcinoma ( EJ4) (ID# 7871) | Lung Adenocarcinoma (H23) | GAAGACGAGCGGCGAGTGTTATTACGCTTGGAAACAACCCC | https://www.aptagen.com/apta-index/ | Cells | null | null | 60 nM | 197 | https://jc-biotechaiteam.com/AptaCom/0197-2/ |
N Mor-Vaknin et al. DEK-targeting DNA aptamers as therapeutics for inflammatory arthritis. Nature Communications 8(2017): 14252.Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer to human immunoglobulin G." RNA Journal 14,(2008): 1154-1163. | DNA | DTA-64 (ID# 7978) | DEK | GGGGTTAAATATTCCCACATTGCCTGCGCCAGTACAAATAG | https://www.aptagen.com/apta-index/ | Protein | null | null | N/A µM | 198 | https://jc-biotechaiteam.com/AptaCom/0198-2/ |
Hannongbua, S., Ratanabunyong, S., Aeksiri, N., Yanaka, S., Yagi-Utsumi, M., Kato, K., & Choowongkomol, K. (2020). Characterization of new DNA Aptamers for anti‐HIV‐1 Reverse Transcriptase. ChemBioChem. doi:10.1002/cbic.202000633Miyakawa, Shin, et al. "Structural and molecular basis for hyperspecificity of RNA aptamer ... | DNA | WT62 (ID# 8071) | HIV-1 Reverse Transcriptase | TCGGTTGAGTGAGATTAGTCAAATGTTTAGAAGACAACCTC | https://www.aptagen.com/apta-index/ | Protein | null | null | 7.51±0.29x10^-8 nM | 199 | https://jc-biotechaiteam.com/AptaCom/0199-2/ |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.