task_id stringlengths 3 79 | question_id int64 1 3.24k | difficulty stringclasses 3
values | tags listlengths 1 10 | problem_description stringlengths 190 3.74k | starter_code stringlengths 57 452 | estimated_date timestamp[s]date 2015-08-07 00:00:00 2024-07-28 00:00:00 | prompt stringclasses 4
values | completion stringlengths 82 3.78k | entry_point stringlengths 14 56 | test stringlengths 55 534k | input_output listlengths 3 451 | query stringlengths 663 4.24k | response stringlengths 104 7.8k |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
binary-tree-level-order-traversal | 102 | Medium | [
"Tree",
"Breadth-First Search",
"Binary Tree"
] | Given the root of a binary tree, return the level order traversal of its nodes' values. (i.e., from left to right, level by level).
Example 1:
Input: root = [3,9,20,null,null,15,7]
Output: [[3],[9,20],[15,7]]
Example 2:
Input: root = [1]
Output: [[1]]
Example 3:
Input: root = []
Output: []
Constraints:
The ... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def levelOrder(self, root: Optional[TreeNode]) -> List[List[int]]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def levelOrder(self, root: Optional[TreeNode]) -> List[List[int]]:
ans = []
if root is None:... | Solution().levelOrder | def check(candidate):
assert candidate(root = tree_node([3, 9, 20, None, None, 15, 7])) == [[3], [9, 20], [15, 7]]
assert candidate(root = tree_node([1])) == [[1]]
assert candidate(root = tree_node([])) == []
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7])) == [[1], [2, 3], [4, 5, 6, 7]]
as... | [
{
"input": "root = [3,9,20,null,null,15,7]",
"output": "[[3], [9, 20], [15, 7]]"
},
{
"input": "root = [1]",
"output": "[[1]]"
},
{
"input": "root = []",
"output": "[]"
},
{
"input": "root = [1,2,3,4,5,6,7]",
"output": "[[1], [2, 3], [4, 5, 6, 7]]"
},
{
"input": "... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree, return the level order traversal of its nodes' values. (i.e., from left to right, leve... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
from collections import deque
from typing import Optional, List
class Solution:
def levelOrder(self, root: Option... |
binary-tree-zigzag-level-order-traversal | 103 | Medium | [
"Tree",
"Breadth-First Search",
"Binary Tree"
] | Given the root of a binary tree, return the zigzag level order traversal of its nodes' values. (i.e., from left to right, then right to left for the next level and alternate between).
Example 1:
Input: root = [3,9,20,null,null,15,7]
Output: [[3],[20,9],[15,7]]
Example 2:
Input: root = [1]
Output: [[1]]
Example 3... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def zigzagLevelOrder(self, root: Optional[TreeNode]) -> List[List[int]]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def zigzagLevelOrder(self, root: Optional[TreeNode]) -> List[List[int]]:
ans = []
if root is... | Solution().zigzagLevelOrder | def check(candidate):
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7])) == [[1], [3, 2], [4, 5, 6, 7]]
assert candidate(root = tree_node([1, None, 2, None, 3, None, 4, None, 5])) == [[1], [2], [3], [4], [5]]
assert candidate(root = tree_node([3, 5, 1, 6, 2, 0, 8, None, None, 7, 4])) == [[3], [1, 5],... | [
{
"input": "root = [1,2,3,4,5,6,7]",
"output": "[[1], [3, 2], [4, 5, 6, 7]]"
},
{
"input": "root = [1,null,2,null,3,null,4,null,5]",
"output": "[[1], [2], [3], [4], [5]]"
},
{
"input": "root = [3,5,1,6,2,0,8,null,null,7,4]",
"output": "[[3], [1, 5], [6, 2, 0, 8], [4, 7]]"
},
{
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree, return the zigzag level order traversal of its nodes' values. (i.e., from left to righ... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
from collections import deque
from typing import List, Optional
class Solution:
def zigzagLevelOrder(self, root: ... |
maximum-depth-of-binary-tree | 104 | Easy | [
"Tree",
"Depth-First Search",
"Breadth-First Search",
"Binary Tree"
] | Given the root of a binary tree, return its maximum depth.
A binary tree's maximum depth is the number of nodes along the longest path from the root node down to the farthest leaf node.
Example 1:
Input: root = [3,9,20,null,null,15,7]
Output: 3
Example 2:
Input: root = [1,null,2]
Output: 2
Constraints:
The nu... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def maxDepth(self, root: Optional[TreeNode]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def maxDepth(self, root: TreeNode) -> int:
if root is None:
return 0
l, r = self... | Solution().maxDepth | def check(candidate):
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7])) == 3
assert candidate(root = tree_node([1, 2, 2, 3, 3, None, None, 4, 4, 5, 5])) == 4
assert candidate(root = tree_node([1, None, 2, None, 3, None, 4, None, 5])) == 5
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7, 8... | [
{
"input": "root = [1,2,3,4,5,6,7]",
"output": "3"
},
{
"input": "root = [1,2,2,3,3,null,null,4,4,5,5]",
"output": "4"
},
{
"input": "root = [1,null,2,null,3,null,4,null,5]",
"output": "5"
},
{
"input": "root = [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15]",
"output": "4"
},
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree, return its maximum depth.
A binary tree's maximum depth is the number of nodes along t... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def maxDepth(self, root: Optional[TreeNode]) -> int:
if not root:
return 0
... |
construct-binary-tree-from-preorder-and-inorder-traversal | 105 | Medium | [
"Tree",
"Array",
"Hash Table",
"Divide and Conquer",
"Binary Tree"
] | Given two integer arrays preorder and inorder where preorder is the preorder traversal of a binary tree and inorder is the inorder traversal of the same tree, construct and return the binary tree.
Example 1:
Input: preorder = [3,9,20,15,7], inorder = [9,3,15,20,7]
Output: [3,9,20,null,null,15,7]
Example 2:
Input:... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def buildTree(self, preorder: List[int], inorder: List[int]) -> Optional[TreeNode]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def buildTree(self, preorder: List[int], inorder: List[int]) -> Optional[TreeNode]:
def dfs(i: int, ... | Solution().buildTree | def check(candidate):
assert is_same_tree(candidate(preorder = [3, 9, 20, 15, 7],inorder = [9, 3, 15, 20, 7]), tree_node([3, 9, 20, None, None, 15, 7]))
assert is_same_tree(candidate(preorder = [1, 2, 4, 5, 3, 6, 7],inorder = [4, 2, 5, 1, 6, 3, 7]), tree_node([1, 2, 3, 4, 5, 6, 7]))
assert is_same_tree(cand... | [
{
"input": "preorder = [1,2,3,4,5], inorder = [4,2,5,1,3]",
"output": "Error: list index out of range"
},
{
"input": "preorder = [3,9,20,15,7], inorder = [9,3,15,20,7]",
"output": "[3, 9, 20, None, None, 15, 7]"
},
{
"input": "preorder = [1,2,4,5,3,6,7], inorder = [4,2,5,1,6,3,7]",
"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given two integer arrays preorder and inorder where preorder is the preorder traversal of a binary tree and inorder is ... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
from typing import List, Optional
class Solution:
def buildTree(self, preorder: List[int], inorder: List[int]) ->... |
construct-binary-tree-from-inorder-and-postorder-traversal | 106 | Medium | [
"Tree",
"Array",
"Hash Table",
"Divide and Conquer",
"Binary Tree"
] | Given two integer arrays inorder and postorder where inorder is the inorder traversal of a binary tree and postorder is the postorder traversal of the same tree, construct and return the binary tree.
Example 1:
Input: inorder = [9,3,15,20,7], postorder = [9,15,7,20,3]
Output: [3,9,20,null,null,15,7]
Example 2:
In... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def buildTree(self, inorder: List[int], postorder: List[int]) -> Optional[TreeNode]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def buildTree(self, inorder: List[int], postorder: List[int]) -> Optional[TreeNode]:
def dfs(i: int,... | Solution().buildTree | def check(candidate):
assert is_same_tree(candidate(inorder = [-1],postorder = [-1]), tree_node([-1]))
assert is_same_tree(candidate(inorder = [1, 2],postorder = [2, 1]), tree_node([1, None, 2]))
assert is_same_tree(candidate(inorder = [3, 2, 1],postorder = [3, 2, 1]), tree_node([1, 2, None, 3]))
assert... | [
{
"input": "inorder = [-1], postorder = [-1]",
"output": "[-1]"
},
{
"input": "inorder = [1,2], postorder = [2,1]",
"output": "[1, None, 2]"
},
{
"input": "inorder = [3,2,1], postorder = [3,2,1]",
"output": "[1, 2, None, 3]"
},
{
"input": "inorder = [1,2,3,4,5], postorder = [... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given two integer arrays inorder and postorder where inorder is the inorder traversal of a binary tree and postorder is... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def buildTree(self, inorder: List[int], postorder: List[int]) -> Optional[TreeNode]:
if no... |
binary-tree-level-order-traversal-ii | 107 | Medium | [
"Tree",
"Breadth-First Search",
"Binary Tree"
] | Given the root of a binary tree, return the bottom-up level order traversal of its nodes' values. (i.e., from left to right, level by level from leaf to root).
Example 1:
Input: root = [3,9,20,null,null,15,7]
Output: [[15,7],[9,20],[3]]
Example 2:
Input: root = [1]
Output: [[1]]
Example 3:
Input: root = []
Outp... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def levelOrderBottom(self, root: Optional[TreeNode]) -> List[List[int]]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def levelOrderBottom(self, root: Optional[TreeNode]) -> List[List[int]]:
ans = []
if root is... | Solution().levelOrderBottom | def check(candidate):
assert candidate(root = tree_node([3, 9, 20, None, None, 15, 7])) == [[15, 7], [9, 20], [3]]
assert candidate(root = tree_node([1])) == [[1]]
assert candidate(root = tree_node([])) == []
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7])) == [[4, 5, 6, 7], [2, 3], [1]]
as... | [
{
"input": "root = [3,9,20,null,null,15,7]",
"output": "[[15, 7], [9, 20], [3]]"
},
{
"input": "root = [1]",
"output": "[[1]]"
},
{
"input": "root = []",
"output": "[]"
},
{
"input": "root = [1,2,3,4,5,6,7]",
"output": "[[4, 5, 6, 7], [2, 3], [1]]"
},
{
"input": "... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree, return the bottom-up level order traversal of its nodes' values. (i.e., from left to r... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
from collections import deque
from typing import List, Optional
class Solution:
def levelOrderBottom(self, root: ... |
convert-sorted-array-to-binary-search-tree | 108 | Easy | [
"Tree",
"Binary Search Tree",
"Array",
"Divide and Conquer",
"Binary Tree"
] | Given an integer array nums where the elements are sorted in ascending order, convert it to a height-balanced binary search tree.
Example 1:
Input: nums = [-10,-3,0,5,9]
Output: [0,-3,9,-10,null,5]
Explanation: [0,-10,5,null,-3,null,9] is also accepted:
Example 2:
Input: nums = [1,3]
Output: [3,1]
Explanation: ... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def sortedArrayToBST(self, nums: List[int]) -> Optional[TreeNode]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def sortedArrayToBST(self, nums: List[int]) -> Optional[TreeNode]:
def dfs(l: int, r: int) -> Option... | Solution().sortedArrayToBST | def check(candidate):
assert is_same_tree(candidate(nums = [0]), tree_node([0]))
assert is_same_tree(candidate(nums = [1, 3]), tree_node([1, None, 3]))
assert is_same_tree(candidate(nums = [-10, -3, 0, 5, 9]), tree_node([0, -10, 5, None, -3, None, 9]))
assert is_same_tree(candidate(nums = [-1, 0, 1, 2])... | [
{
"input": "nums = [0]",
"output": "[0]"
},
{
"input": "nums = [1,3]",
"output": "[1, None, 3]"
},
{
"input": "nums = [-10,-3,0,5,9]",
"output": "[0, -10, 5, None, -3, None, 9]"
},
{
"input": "nums = [-1,0,1,2]",
"output": "[0, -1, 1, None, None, None, 2]"
},
{
"i... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer array nums where the elements are sorted in ascending order, convert it to a height-balanced binary se... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def sortedArrayToBST(self, nums: List[int]) -> Optional[TreeNode]:
def helper(left, right)... |
convert-sorted-list-to-binary-search-tree | 109 | Medium | [
"Tree",
"Binary Search Tree",
"Linked List",
"Divide and Conquer",
"Binary Tree"
] | Given the head of a singly linked list where elements are sorted in ascending order, convert it to a height-balanced binary search tree.
Example 1:
Input: head = [-10,-3,0,5,9]
Output: [0,-3,9,-10,null,5]
Explanation: One possible answer is [0,-3,9,-10,null,5], which represents the shown height balanced BST.
Examp... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# ... | 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# ... | Solution().sortedListToBST | def check(candidate):
assert is_same_tree(candidate(head = list_node([1, 2, 3, 4, 5, 6, 7])), tree_node([4, 2, 6, 1, 3, 5, 7]))
assert is_same_tree(candidate(head = list_node([-1, 0, 1, 2])), tree_node([0, -1, 1, None, None, None, 2]))
assert is_same_tree(candidate(head = list_node([-10, -5, 0, 5, 10])), tr... | [
{
"input": "head = [1,2,3,4,5,6,7]",
"output": "[4, 2, 6, 1, 3, 5, 7]"
},
{
"input": "head = [-1,0,1,2]",
"output": "[0, -1, 1, None, None, None, 2]"
},
{
"input": "head = [-10,-5,0,5,10]",
"output": "[0, -10, 5, None, -5, None, 10]"
},
{
"input": "head = [0,1,2,3,4,5,6,7,8,9... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the head of a singly linked list where elements are sorted in ascending order, convert it to a height-balanced bi... | ```python
# Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = l... |
balanced-binary-tree | 110 | Easy | [
"Tree",
"Depth-First Search",
"Binary Tree"
] | Given a binary tree, determine if it is height-balanced.
Example 1:
Input: root = [3,9,20,null,null,15,7]
Output: true
Example 2:
Input: root = [1,2,2,3,3,null,null,4,4]
Output: false
Example 3:
Input: root = []
Output: true
Constraints:
The number of nodes in the tree is in the range [0, 5000].
-104 <= No... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def isBalanced(self, root: Optional[TreeNode]) -> bool:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def isBalanced(self, root: Optional[TreeNode]) -> bool:
def height(root):
if root is Non... | Solution().isBalanced | def check(candidate):
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, None, 7])) == True
assert candidate(root = tree_node([1, 2, 2, 3, 3, 3, 3, 4, 4, 4, 4, 4, 4, None, None, 5, 5])) == True
assert candidate(root = tree_node([1, 2, 2, 3, None, None, 3, 4, 4, 4, 4])) == False
assert candidate(root =... | [
{
"input": "root = [1,2,3,4,5,6,null,7]",
"output": "True"
},
{
"input": "root = [1,2,2,3,3,3,3,4,4,4,4,4,4,null,null,5,5]",
"output": "True"
},
{
"input": "root = [1,2,2,3,null,null,3,4,4,4,4]",
"output": "False"
},
{
"input": "root = [1,2,2,3,4,4,3]",
"output": "True"
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a binary tree, determine if it is height-balanced.
Example 1:
Input: root = [3,9,20,null,null,15,7]
Output: t... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
from typing import Optional
class Solution:
def isBalanced(self, root: Optional[TreeNode]) -> bool:
def c... |
minimum-depth-of-binary-tree | 111 | Easy | [
"Tree",
"Depth-First Search",
"Breadth-First Search",
"Binary Tree"
] | Given a binary tree, find its minimum depth.
The minimum depth is the number of nodes along the shortest path from the root node down to the nearest leaf node.
Note: A leaf is a node with no children.
Example 1:
Input: root = [3,9,20,null,null,15,7]
Output: 2
Example 2:
Input: root = [2,null,3,null,4,null,5,null,... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def minDepth(self, root: Optional[TreeNode]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def minDepth(self, root: Optional[TreeNode]) -> int:
if root is None:
return 0
i... | Solution().minDepth | def check(candidate):
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7])) == 3
assert candidate(root = tree_node([0, 2, 4, 1, None, 3, -1, 5, 1, None, 6, None, 8])) == 4
assert candidate(root = tree_node([1, None, 2, None, 3, None, 4, None, 5])) == 5
assert candidate(root = tree_node([0, 1, 2, 3, ... | [
{
"input": "root = [1,2,3,4,5,6,7]",
"output": "3"
},
{
"input": "root = [0,2,4,1,null,3,-1,5,1,null,6,null,8]",
"output": "4"
},
{
"input": "root = [1,null,2,null,3,null,4,null,5]",
"output": "5"
},
{
"input": "root = [0,1,2,3,4,5,6,7,8,9]",
"output": "3"
},
{
"i... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a binary tree, find its minimum depth.
The minimum depth is the number of nodes along the shortest path from the ... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def minDepth(self, root: Optional[TreeNode]) -> int:
if not root:
return 0
... |
path-sum | 112 | Easy | [
"Tree",
"Depth-First Search",
"Breadth-First Search",
"Binary Tree"
] | Given the root of a binary tree and an integer targetSum, return true if the tree has a root-to-leaf path such that adding up all the values along the path equals targetSum.
A leaf is a node with no children.
Example 1:
Input: root = [5,4,8,11,null,13,4,7,2,null,null,null,1], targetSum = 22
Output: true
Explanation... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def hasPathSum(self, root: Optional[TreeNode], targetSum: int) -> bool:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def hasPathSum(self, root: Optional[TreeNode], targetSum: int) -> bool:
def dfs(root, s):
... | Solution().hasPathSum | def check(candidate):
assert candidate(root = tree_node([]),targetSum = 0) == False
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7]),targetSum = 10) == True
assert candidate(root = tree_node([1, -2, -3, 1, 3, -2, None, -1]),targetSum = 3) == False
assert candidate(root = tree_node([1, 2]),target... | [
{
"input": "root = [], targetSum = 0",
"output": "False"
},
{
"input": "root = [1,2,3,4,5,6,7], targetSum = 10",
"output": "True"
},
{
"input": "root = [1,-2,-3,1,3,-2,null,-1], targetSum = 3",
"output": "False"
},
{
"input": "root = [1,2], targetSum = 3",
"output": "True... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree and an integer targetSum, return true if the tree has a root-to-leaf path such that add... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def hasPathSum(self, root: Optional[TreeNode], targetSum: int) -> bool:
if not root:
... |
path-sum-ii | 113 | Medium | [
"Tree",
"Depth-First Search",
"Backtracking",
"Binary Tree"
] | Given the root of a binary tree and an integer targetSum, return all root-to-leaf paths where the sum of the node values in the path equals targetSum. Each path should be returned as a list of the node values, not node references.
A root-to-leaf path is a path starting from the root and ending at any leaf node. A leaf ... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def pathSum(self, root: Optional[TreeNode], targetSum: int) -> List[List[int]]:
| 2015-08-07T00:00:00 | import heapq
import itertools
from sortedcontainers import SortedList
import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def pathSum(self, root: Optional[TreeNode], targetSum: int) -> List[List[int]]:
def dfs(root, s):
... | Solution().pathSum | def check(candidate):
assert candidate(root = tree_node([0, 1, 1]),targetSum = 1) == [[0, 1], [0, 1]]
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15]),targetSum = 45) == []
assert candidate(root = tree_node([1, None, 2, None, 3, None, 4, None, 5, None, 6]),targetSum = 2... | [
{
"input": "targetSum",
"output": "Error: Solution.pathSum() missing 2 required positional arguments: 'root' and 'targetSum'"
},
{
"input": "root",
"output": "Error: Solution.pathSum() missing 2 required positional arguments: 'root' and 'targetSum'"
},
{
"input": "root = [0,1,1], targetS... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree and an integer targetSum, return all root-to-leaf paths where the sum of the node value... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def pathSum(self, root: Optional[TreeNode], targetSum: int) -> List[List[int]]:
def dfs(no... |
flatten-binary-tree-to-linked-list | 114 | Medium | [
"Stack",
"Tree",
"Depth-First Search",
"Linked List",
"Binary Tree"
] | Given the root of a binary tree, flatten the tree into a "linked list":
The "linked list" should use the same TreeNode class where the right child pointer points to the next node in the list and the left child pointer is always null.
The "linked list" should be in the same order as a pre-order traversal of the binary ... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def flatten(self, root: Optional[TreeNode]) -> None:
"""
Do not return anything, modify root... | 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def flatten(self, root: Optional[TreeNode]) -> None:
"""
Do not return anything, modify root... | Solution().flatten | def check(candidate):
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7])) == None
assert candidate(root = tree_node([1, None, 2, None, 3, None, 4, None, 5, None, 6, None, 7])) == None
assert candidate(root = tree_node([1, 2, 3, 4])) == None
assert candidate(root = tree_node([1, None, 2, None, 3, N... | [
{
"input": "root = [1,2,3,4,5,6,7]",
"output": "None"
},
{
"input": "root = [1,null,2,null,3,null,4,null,5,null,6,null,7]",
"output": "None"
},
{
"input": "root = [1,2,3,4]",
"output": "None"
},
{
"input": "root = [1,null,2,null,3,null,4,null,5,null,6]",
"output": "None"
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree, flatten the tree into a "linked list":
The "linked list" should use the same TreeNode... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def flatten(self, root: Optional[TreeNode]) -> None:
"""
Do not return anything, m... |
distinct-subsequences | 115 | Hard | [
"String",
"Dynamic Programming"
] | Given two strings s and t, return the number of distinct subsequences of s which equals t.
The test cases are generated so that the answer fits on a 32-bit signed integer.
Example 1:
Input: s = "rabbbit", t = "rabbit"
Output: 3
Explanation:
As shown below, there are 3 ways you can generate "rabbit" from s.
rabbbit
r... | class Solution:
def numDistinct(self, s: str, t: str) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def numDistinct(self, s: str, t: str) -> int:
m, n = len(s), len(t)
f = [[0] * (n + 1) for _ in range(m + 1)]
for i in range(m + 1):
f[i][0] = 1
for i, a in enumerate(s, 1):
for j, b in enumerate(t, 1):
f[i][j] = f[i - 1][j]
... | Solution().numDistinct | def check(candidate):
assert candidate(s = "abc",t = "abcd") == 0
assert candidate(s = "abcd",t = "abcd") == 1
assert candidate(s = "rabbbit",t = "rabbit") == 3
assert candidate(s = "aaa",t = "a") == 3
assert candidate(s = "",t = "abc") == 0
assert candidate(s = "mississippi",t = "isip") == 16
... | [
{
"input": "s = \"abc\", t = \"abcd\"",
"output": "0"
},
{
"input": "s = \"abcd\", t = \"abcd\"",
"output": "1"
},
{
"input": "s = \"rabbbit\", t = \"rabbit\"",
"output": "3"
},
{
"input": "s = \"aaa\", t = \"a\"",
"output": "3"
},
{
"input": "s = \"\", t = \"abc\... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given two strings s and t, return the number of distinct subsequences of s which equals t.
The test cases are generated... | ```python
class Solution:
def numDistinct(self, s: str, t: str) -> int:
m, n = len(s), len(t)
# dp[i][j] will store the number of distinct subsequences of s[:i] which equals t[:j]
dp = [[0] * (n + 1) for _ in range(m + 1)]
# An empty t can be formed from any prefix of s by n... |
pascals-triangle | 118 | Easy | [
"Array",
"Dynamic Programming"
] | Given an integer numRows, return the first numRows of Pascal's triangle.
In Pascal's triangle, each number is the sum of the two numbers directly above it as shown:
Example 1:
Input: numRows = 5
Output: [[1],[1,1],[1,2,1],[1,3,3,1],[1,4,6,4,1]]
Example 2:
Input: numRows = 1
Output: [[1]]
Constraints:
1 <= numRow... | class Solution:
def generate(self, numRows: int) -> List[List[int]]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def generate(self, numRows: int) -> List[List[int]]:
f = [[1]]
for i in range(numRows - 1):
g = [1] + [a + b for a, b in pairwise(f[-1])] + [1]
f.append(g)
return f
| Solution().generate | def check(candidate):
assert candidate(numRows = 10) == [[1], [1, 1], [1, 2, 1], [1, 3, 3, 1], [1, 4, 6, 4, 1], [1, 5, 10, 10, 5, 1], [1, 6, 15, 20, 15, 6, 1], [1, 7, 21, 35, 35, 21, 7, 1], [1, 8, 28, 56, 70, 56, 28, 8, 1], [1, 9, 36, 84, 126, 126, 84, 36, 9, 1]]
assert candidate(numRows = 3) == [[1], [1, 1], [... | [
{
"input": "numRows = 10",
"output": "[[1], [1, 1], [1, 2, 1], [1, 3, 3, 1], [1, 4, 6, 4, 1], [1, 5, 10, 10, 5, 1], [1, 6, 15, 20, 15, 6, 1], [1, 7, 21, 35, 35, 21, 7, 1], [1, 8, 28, 56, 70, 56, 28, 8, 1], [1, 9, 36, 84, 126, 126, 84, 36, 9, 1]]"
},
{
"input": "numRows = 3",
"output": "[[1], [1,... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer numRows, return the first numRows of Pascal's triangle.
In Pascal's triangle, each number is the sum o... | ```python
from typing import List
class Solution:
def generate(self, numRows: int) -> List[List[int]]:
if numRows == 0:
return []
triangle = [[1]]
for i in range(1, numRows):
row = [1]
for j in range(1, i):
row.append(tri... |
pascals-triangle-ii | 119 | Easy | [
"Array",
"Dynamic Programming"
] | Given an integer rowIndex, return the rowIndexth (0-indexed) row of the Pascal's triangle.
In Pascal's triangle, each number is the sum of the two numbers directly above it as shown:
Example 1:
Input: rowIndex = 3
Output: [1,3,3,1]
Example 2:
Input: rowIndex = 0
Output: [1]
Example 3:
Input: rowIndex = 1
Output: [1,... | class Solution:
def getRow(self, rowIndex: int) -> List[int]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def getRow(self, rowIndex: int) -> List[int]:
f = [1] * (rowIndex + 1)
for i in range(2, rowIndex + 1):
for j in range(i - 1, 0, -1):
f[j] += f[j - 1]
return f
| Solution().getRow | def check(candidate):
assert candidate(rowIndex = 0) == [1]
assert candidate(rowIndex = 10) == [1, 10, 45, 120, 210, 252, 210, 120, 45, 10, 1]
assert candidate(rowIndex = 15) == [1, 15, 105, 455, 1365, 3003, 5005, 6435, 6435, 5005, 3003, 1365, 455, 105, 15, 1]
assert candidate(rowIndex = 1) == [1, 1]
... | [
{
"input": "rowIndex = 0",
"output": "[1]"
},
{
"input": "rowIndex = 10",
"output": "[1, 10, 45, 120, 210, 252, 210, 120, 45, 10, 1]"
},
{
"input": "rowIndex = 15",
"output": "[1, 15, 105, 455, 1365, 3003, 5005, 6435, 6435, 5005, 3003, 1365, 455, 105, 15, 1]"
},
{
"input": "r... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer rowIndex, return the rowIndexth (0-indexed) row of the Pascal's triangle.
In Pascal's triangle, each n... | ```python
class Solution:
def getRow(self, rowIndex: int) -> List[int]:
# Initialize the row with 1s
row = [1] * (rowIndex + 1)
# Calculate each element of the row except the first and last
for i in range(1, rowIndex):
# Calculate from the end to the start to avo... |
triangle | 120 | Medium | [
"Array",
"Dynamic Programming"
] | Given a triangle array, return the minimum path sum from top to bottom.
For each step, you may move to an adjacent number of the row below. More formally, if you are on index i on the current row, you may move to either index i or index i + 1 on the next row.
Example 1:
Input: triangle = [[2],[3,4],[6,5,7],[4,1,8,3]... | class Solution:
def minimumTotal(self, triangle: List[List[int]]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def minimumTotal(self, triangle: List[List[int]]) -> int:
n = len(triangle)
f = [[0] * (n + 1) for _ in range(n + 1)]
for i in range(n - 1, -1, -1):
for j in range(i + 1):
f[i][j] = min(f[i + 1][j], f[i + 1][j + 1]) + triangle[i][j]
return ... | Solution().minimumTotal | def check(candidate):
assert candidate(triangle = [[-10]]) == -10
assert candidate(triangle = [[-1], [2, 3], [1, -1, -3], [-2, 1, -1, -2]]) == -3
assert candidate(triangle = [[0], [1, 2], [3, 4, 5], [6, 7, 8, 9]]) == 10
assert candidate(triangle = [[-1], [2, -2], [3, -3, 3], [-4, -4, 4, 4]]) == -10
... | [
{
"input": "triangle = [[-10]]",
"output": "-10"
},
{
"input": "triangle = [[-1],[2,3],[1,-1,-3],[-2,1,-1,-2]]",
"output": "-3"
},
{
"input": "triangle = [[0],[1,2],[3,4,5],[6,7,8,9]]",
"output": "10"
},
{
"input": "triangle = [[-1],[2,-2],[3,-3,3],[-4,-4,4,4]]",
"output"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a triangle array, return the minimum path sum from top to bottom.
For each step, you may move to an adjacent numb... | ```python
from typing import List
class Solution:
def minimumTotal(self, triangle: List[List[int]]) -> int:
n = len(triangle)
# Initialize a DP array with an extra column for easier calculations
dp = [0] * (n + 1)
# Start from the bottom of the triangle and move upwards
... |
best-time-to-buy-and-sell-stock | 121 | Easy | [
"Array",
"Dynamic Programming"
] | You are given an array prices where prices[i] is the price of a given stock on the ith day.
You want to maximize your profit by choosing a single day to buy one stock and choosing a different day in the future to sell that stock.
Return the maximum profit you can achieve from this transaction. If you cannot achieve any... | class Solution:
def maxProfit(self, prices: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def maxProfit(self, prices: List[int]) -> int:
ans, mi = 0, inf
for v in prices:
ans = max(ans, v - mi)
mi = min(mi, v)
return ans
| Solution().maxProfit | def check(candidate):
assert candidate(prices = [10, 9, 8, 2]) == 0
assert candidate(prices = [1]) == 0
assert candidate(prices = [2, 1, 2, 1, 0, 1, 2]) == 2
assert candidate(prices = [2, 1]) == 0
assert candidate(prices = [7, 6, 4, 3, 1]) == 0
assert candidate(prices = [3, 3, 5, 0, 0, 3, 1, 4])... | [
{
"input": "prices = [10,9,8,2]",
"output": "0"
},
{
"input": "prices = [1]",
"output": "0"
},
{
"input": "prices = [2,1,2,1,0,1,2]",
"output": "2"
},
{
"input": "prices = [2,1]",
"output": "0"
},
{
"input": "prices = [7,6,4,3,1]",
"output": "0"
},
{
"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given an array prices where prices[i] is the price of a given stock on the ith day.
You want to maximize your p... | ```python
from typing import List
class Solution:
def maxProfit(self, prices: List[int]) -> int:
if not prices:
return 0
min_price = prices[0]
max_profit = 0
for price in prices:
if price < min_price:
min_price = price
... |
best-time-to-buy-and-sell-stock-ii | 122 | Medium | [
"Greedy",
"Array",
"Dynamic Programming"
] | You are given an integer array prices where prices[i] is the price of a given stock on the ith day.
On each day, you may decide to buy and/or sell the stock. You can only hold at most one share of the stock at any time. However, you can buy it then immediately sell it on the same day.
Find and return the maximum profit... | class Solution:
def maxProfit(self, prices: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def maxProfit(self, prices: List[int]) -> int:
return sum(max(0, b - a) for a, b in pairwise(prices))
| Solution().maxProfit | def check(candidate):
assert candidate(prices = [1, 1, 1, 1, 1, 1, 1]) == 0
assert candidate(prices = [1, 2, 2, 3, 4, 4, 5]) == 4
assert candidate(prices = [10, 9, 8, 7, 6, 5, 4, 3, 2, 1]) == 0
assert candidate(prices = [1, 2, 1, 2, 1, 2, 1]) == 3
assert candidate(prices = [6, 5, 4, 3, 2, 1]) == 0
... | [
{
"input": "prices = [1,1,1,1,1,1,1]",
"output": "0"
},
{
"input": "prices = [1,2,2,3,4,4,5]",
"output": "4"
},
{
"input": "prices = [10,9,8,7,6,5,4,3,2,1]",
"output": "0"
},
{
"input": "prices = [1,2,1,2,1,2,1]",
"output": "3"
},
{
"input": "prices = [6,5,4,3,2,1... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given an integer array prices where prices[i] is the price of a given stock on the ith day.
On each day, you ma... | ```python
from typing import List
class Solution:
def maxProfit(self, prices: List[int]) -> int:
max_profit = 0
for i in range(1, len(prices)):
if prices[i] > prices[i - 1]:
max_profit += prices[i] - prices[i - 1]
return max_profit
```
This solution iterates thr... |
best-time-to-buy-and-sell-stock-iii | 123 | Hard | [
"Array",
"Dynamic Programming"
] | You are given an array prices where prices[i] is the price of a given stock on the ith day.
Find the maximum profit you can achieve. You may complete at most two transactions.
Note: You may not engage in multiple transactions simultaneously (i.e., you must sell the stock before you buy again).
Example 1:
Input: pric... | class Solution:
def maxProfit(self, prices: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def maxProfit(self, prices: List[int]) -> int:
# 第一次买入,第一次卖出,第二次买入,第二次卖出
f1, f2, f3, f4 = -prices[0], 0, -prices[0], 0
for price in prices[1:]:
f1 = max(f1, -price)
f2 = max(f2, f1 + price)
f3 = max(f3, f2 - price)
f4 = max(f4, ... | Solution().maxProfit | def check(candidate):
assert candidate(prices = [1, 5, 1, 5, 1, 5, 1, 5]) == 8
assert candidate(prices = [2, 1, 4, 5, 2, 9, 7]) == 11
assert candidate(prices = [10, 22, 5, 75, 65, 80]) == 87
assert candidate(prices = [10, 9, 8, 7, 6, 5, 4, 3, 2, 1]) == 0
assert candidate(prices = [3, 2, 6, 5, 0, 3])... | [
{
"input": "prices = [1,5,1,5,1,5,1,5]",
"output": "8"
},
{
"input": "prices = [2,1,4,5,2,9,7]",
"output": "11"
},
{
"input": "prices = [10,22,5,75,65,80]",
"output": "87"
},
{
"input": "prices = [10,9,8,7,6,5,4,3,2,1]",
"output": "0"
},
{
"input": "prices = [3,2,... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given an array prices where prices[i] is the price of a given stock on the ith day.
Find the maximum profit you... | ```python
from typing import List
class Solution:
def maxProfit(self, prices: List[int]) -> int:
if not prices:
return 0
# Initialize variables to track the minimum cost and maximum profit for up to two transactions
min_cost1 = float('inf')
min_cost2 = float('inf')
... |
binary-tree-maximum-path-sum | 124 | Hard | [
"Tree",
"Depth-First Search",
"Dynamic Programming",
"Binary Tree"
] | A path in a binary tree is a sequence of nodes where each pair of adjacent nodes in the sequence has an edge connecting them. A node can only appear in the sequence at most once. Note that the path does not need to pass through the root.
The path sum of a path is the sum of the node's values in the path.
Given the root... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def maxPathSum(self, root: Optional[TreeNode]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def maxPathSum(self, root: Optional[TreeNode]) -> int:
def dfs(root: Optional[TreeNode]) -> int:
... | Solution().maxPathSum | def check(candidate):
assert candidate(root = tree_node([1, None, 2, None, 3, None, 4, None, 5])) == 15
assert candidate(root = tree_node([2, -1])) == 2
assert candidate(root = tree_node([-3])) == -3
assert candidate(root = tree_node([1, 2, 3])) == 6
assert candidate(root = tree_node([1, -2, -3])) =... | [
{
"input": "root = [1,null,2,null,3,null,4,null,5]",
"output": "15"
},
{
"input": "root = [2,-1]",
"output": "2"
},
{
"input": "root = [-3]",
"output": "-3"
},
{
"input": "root = [1,2,3]",
"output": "6"
},
{
"input": "root = [1,-2,-3]",
"output": "1"
},
{
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
A path in a binary tree is a sequence of nodes where each pair of adjacent nodes in the sequence has an edge connecting... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def maxPathSum(self, root: Optional[TreeNode]) -> int:
def helper(node):
nonlo... |
valid-palindrome | 125 | Easy | [
"Two Pointers",
"String"
] | A phrase is a palindrome if, after converting all uppercase letters into lowercase letters and removing all non-alphanumeric characters, it reads the same forward and backward. Alphanumeric characters include letters and numbers.
Given a string s, return true if it is a palindrome, or false otherwise.
Example 1:
Inp... | class Solution:
def isPalindrome(self, s: str) -> bool: | 2015-08-07T00:00:00 | import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
| class Solution:
def isPalindrome(self, s: str) -> bool:
i, j = 0, len(s) - 1
while i < j:
if not s[i].isalnum():
i += 1
elif not s[j].isalnum():
j -= 1
elif s[i].lower() != s[j].lower():
return False
else... | Solution().isPalindrome | def check(candidate):
assert candidate(s = "race a car") == False
assert candidate(s = " ") == True
| [
{
"input": "s = \"race a car\"",
"output": "false"
},
{
"input": "s = \" \"",
"output": "true"
},
{
"input": "s = \"Able was I ere I saw Elba\"",
"output": "True"
},
{
"input": "s = \"__Level__, __level__\"",
"output": "True"
},
{
"input": "s = \"No lemon, no melo... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
A phrase is a palindrome if, after converting all uppercase letters into lowercase letters and removing all non-alphanu... | ```python
class Solution:
def isPalindrome(self, s: str) -> bool:
# Convert to lowercase
s = s.lower()
# Filter out non-alphanumeric characters
filtered_chars = [char for char in s if char.isalnum()]
# Join the characters to form the cleaned string
cleaned_string = ''... |
word-ladder | 127 | Hard | [
"Breadth-First Search",
"Hash Table",
"String"
] | A transformation sequence from word beginWord to word endWord using a dictionary wordList is a sequence of words beginWord -> s1 -> s2 -> ... -> sk such that:
Every adjacent pair of words differs by a single letter.
Every si for 1 <= i <= k is in wordList. Note that beginWord does not need to be in wordList.
sk == end... | class Solution:
def ladderLength(self, beginWord: str, endWord: str, wordList: List[str]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def ladderLength(self, beginWord: str, endWord: str, wordList: List[str]) -> int:
words = set(wordList)
q = deque([beginWord])
ans = 1
while q:
ans += 1
for _ in range(len(q)):
s = q.popleft()
s = list(s)
... | Solution().ladderLength | def check(candidate):
assert candidate(beginWord = "leet",endWord = "code",wordList = ['lest', 'leet', 'lose', 'code', 'lode', 'robe', 'home', 'dote', 'cake']) == 0
assert candidate(beginWord = "talk",endWord = "tell",wordList = ['talk', 'tell', 'tall', 'toll', 'toll']) == 3
assert candidate(beginWord = "ta... | [
{
"input": "beginWord = \"leet\", endWord = \"code\", wordList = [\"lest\",\"leet\",\"lose\",\"code\",\"lode\",\"robe\",\"home\",\"dote\",\"cake\"]",
"output": "0"
},
{
"input": "beginWord = \"talk\", endWord = \"tell\", wordList = [\"talk\",\"tell\",\"tall\",\"toll\",\"toll\"]",
"output": "3"
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
A transformation sequence from word beginWord to word endWord using a dictionary wordList is a sequence of words beginW... | ```python
from collections import deque, defaultdict
from typing import List
class Solution:
def ladderLength(self, beginWord: str, endWord: str, wordList: List[str]) -> int:
# If endWord is not in wordList, return 0
if endWord not in wordList:
return 0
# Create a dicti... |
longest-consecutive-sequence | 128 | Medium | [
"Union Find",
"Array",
"Hash Table"
] | Given an unsorted array of integers nums, return the length of the longest consecutive elements sequence.
You must write an algorithm that runs in O(n) time.
Example 1:
Input: nums = [100,4,200,1,3,2]
Output: 4
Explanation: The longest consecutive elements sequence is [1, 2, 3, 4]. Therefore its length is 4.
Exampl... | class Solution:
def longestConsecutive(self, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def longestConsecutive(self, nums: List[int]) -> int:
s = set(nums)
ans = 0
d = defaultdict(int)
for x in nums:
y = x
while y in s:
s.remove(y)
y += 1
d[x] = d[y] + y - x
ans = max(ans, d[... | Solution().longestConsecutive | def check(candidate):
assert candidate(nums = [-1, -2, -3, -4]) == 4
assert candidate(nums = [10, 5, 12, 3, 9, 7, 8, 11]) == 6
assert candidate(nums = [1, 9, 3, 10, 4, 20, 2]) == 4
assert candidate(nums = [10, 9, 8, 7, 6, 5, 4, 3, 2, 1]) == 10
assert candidate(nums = [10, 5, 12, 3, 14, 7, 16, 20, 18... | [
{
"input": "nums = [-1, -2, -3, -4]",
"output": "4"
},
{
"input": "nums = [10,5,12,3,9,7,8,11]",
"output": "6"
},
{
"input": "nums = [1,9,3,10,4,20,2]",
"output": "4"
},
{
"input": "nums = [10,9,8,7,6,5,4,3,2,1]",
"output": "10"
},
{
"input": "nums = [10,5,12,3,14... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an unsorted array of integers nums, return the length of the longest consecutive elements sequence.
You must writ... | ```python
from typing import List
class Solution:
def longestConsecutive(self, nums: List[int]) -> int:
if not nums:
return 0
num_set = set(nums)
longest_streak = 0
for num in num_set:
# Check if it's the start of a sequence
if n... |
sum-root-to-leaf-numbers | 129 | Medium | [
"Tree",
"Depth-First Search",
"Binary Tree"
] | You are given the root of a binary tree containing digits from 0 to 9 only.
Each root-to-leaf path in the tree represents a number.
For example, the root-to-leaf path 1 -> 2 -> 3 represents the number 123.
Return the total sum of all root-to-leaf numbers. Test cases are generated so that the answer will fit in a 32-b... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def sumNumbers(self, root: Optional[TreeNode]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def sumNumbers(self, root: Optional[TreeNode]) -> int:
def dfs(root, s):
if root is None... | Solution().sumNumbers | def check(candidate):
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7])) == 522
assert candidate(root = tree_node([9, 3, 20, None, None, 15, 7])) == 2315
assert candidate(root = tree_node([1, 2, 3])) == 25
assert candidate(root = tree_node([1, 0, 0])) == 20
assert candidate(root = tree_node([... | [
{
"input": "root = [1,2,3,4,5,6,7]",
"output": "522"
},
{
"input": "root = [9,3,20,null,null,15,7]",
"output": "2315"
},
{
"input": "root = [1,2,3]",
"output": "25"
},
{
"input": "root = [1,0,0]",
"output": "20"
},
{
"input": "root = [1,0]",
"output": "10"
}... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given the root of a binary tree containing digits from 0 to 9 only.
Each root-to-leaf path in the tree represen... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def sumNumbers(self, root: Optional[TreeNode]) -> int:
def dfs(node, current_number):
... |
surrounded-regions | 130 | Medium | [
"Depth-First Search",
"Breadth-First Search",
"Union Find",
"Array",
"Matrix"
] | You are given an m x n matrix board containing letters 'X' and 'O', capture regions that are surrounded:
Connect: A cell is connected to adjacent cells horizontally or vertically.
Region: To form a region connect every 'O' cell.
Surround: The region is surrounded with 'X' cells if you can connect the region with 'X' c... | class Solution:
def solve(self, board: List[List[str]]) -> None:
"""
Do not return anything, modify board in-place instead.
"""
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def solve(self, board: List[List[str]]) -> None:
def dfs(i: int, j: int):
if not (0 <= i < m and 0 <= j < n and board[i][j] == "O"):
return
board[i][j] = "."
for a, b in pairwise((-1, 0, 1, 0, -1)):
dfs(i + a, j + b)
... | Solution().solve | def check(candidate):
assert candidate(board = [['X', 'X', 'X', 'O'], ['X', 'O', 'O', 'X'], ['X', 'X', 'O', 'X'], ['X', 'O', 'X', 'X']]) == None
assert candidate(board = [['O', 'X', 'X', 'O', 'X'], ['X', 'X', 'X', 'X', 'O'], ['X', 'X', 'X', 'O', 'X'], ['O', 'X', 'X', 'X', 'O'], ['X', 'O', 'O', 'X', 'X']]) == No... | [
{
"input": "board = [[\"X\",\"X\",\"X\",\"O\"],[\"X\",\"O\",\"O\",\"X\"],[\"X\",\"X\",\"O\",\"X\"],[\"X\",\"O\",\"X\",\"X\"]]",
"output": "None"
},
{
"input": "board = [[\"O\",\"X\",\"X\",\"O\",\"X\"],[\"X\",\"X\",\"X\",\"X\",\"O\"],[\"X\",\"X\",\"X\",\"O\",\"X\"],[\"O\",\"X\",\"X\",\"X\",\"O\"],[\"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given an m x n matrix board containing letters 'X' and 'O', capture regions that are surrounded:
Connect: A ce... | To solve this problem, we can use the Depth-First Search (DFS) approach. The idea is to find all 'O's that are connected to the borders and mark them as temporary (e.g., 'T'). Then, we can flip all remaining 'O's to 'X's because they are surrounded by 'X's. Finally, we revert the marked 'T's back to 'O's.
Here is the ... |
palindrome-partitioning | 131 | Medium | [
"String",
"Dynamic Programming",
"Backtracking"
] | Given a string s, partition s such that every substring of the partition is a palindrome. Return all possible palindrome partitioning of s.
Example 1:
Input: s = "aab"
Output: [["a","a","b"],["aa","b"]]
Example 2:
Input: s = "a"
Output: [["a"]]
Constraints:
1 <= s.length <= 16
s contains only lowercase English le... | class Solution:
def partition(self, s: str) -> List[List[str]]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def partition(self, s: str) -> List[List[str]]:
def dfs(i: int):
if i == n:
ans.append(t[:])
return
for j in range(i, n):
if f[i][j]:
t.append(s[i : j + 1])
dfs(j + 1)
... | Solution().partition | def check(candidate):
assert candidate(s = "madam") == [['m', 'a', 'd', 'a', 'm'], ['m', 'ada', 'm'], ['madam']]
assert candidate(s = "deified") == [['d', 'e', 'i', 'f', 'i', 'e', 'd'], ['d', 'e', 'ifi', 'e', 'd'], ['d', 'eifie', 'd'], ['deified']]
assert candidate(s = "repaper") == [['r', 'e', 'p', 'a', 'p... | [
{
"input": "s = \"madam\"",
"output": "[['m', 'a', 'd', 'a', 'm'], ['m', 'ada', 'm'], ['madam']]"
},
{
"input": "s = \"deified\"",
"output": "[['d', 'e', 'i', 'f', 'i', 'e', 'd'], ['d', 'e', 'ifi', 'e', 'd'], ['d', 'eifie', 'd'], ['deified']]"
},
{
"input": "s = \"repaper\"",
"output... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a string s, partition s such that every substring of the partition is a palindrome. Return all possible palindrom... | ```python
from typing import List
class Solution:
def partition(self, s: str) -> List[List[str]]:
def is_palindrome(sub: str) -> bool:
return sub == sub[::-1]
def backtrack(start: int, path: List[str]):
if start == len(s):
result.append(path)
... |
palindrome-partitioning-ii | 132 | Hard | [
"String",
"Dynamic Programming"
] | Given a string s, partition s such that every substring of the partition is a palindrome.
Return the minimum cuts needed for a palindrome partitioning of s.
Example 1:
Input: s = "aab"
Output: 1
Explanation: The palindrome partitioning ["aa","b"] could be produced using 1 cut.
Example 2:
Input: s = "a"
Output: 0
... | class Solution:
def minCut(self, s: str) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def minCut(self, s: str) -> int:
n = len(s)
g = [[True] * n for _ in range(n)]
for i in range(n - 1, -1, -1):
for j in range(i + 1, n):
g[i][j] = s[i] == s[j] and g[i + 1][j - 1]
f = list(range(n))
for i in range(1, n):
... | Solution().minCut | def check(candidate):
assert candidate(s = "abcba") == 0
assert candidate(s = "aabbaa") == 0
assert candidate(s = "abcdcba") == 0
assert candidate(s = "abababab") == 1
assert candidate(s = "a") == 0
assert candidate(s = "ab") == 1
assert candidate(s = "noonnoon") == 0
assert candidate(s ... | [
{
"input": "s = \"abcba\"",
"output": "0"
},
{
"input": "s = \"aabbaa\"",
"output": "0"
},
{
"input": "s = \"abcdcba\"",
"output": "0"
},
{
"input": "s = \"abababab\"",
"output": "1"
},
{
"input": "s = \"a\"",
"output": "0"
},
{
"input": "s = \"ab\"",
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a string s, partition s such that every substring of the partition is a palindrome.
Return the minimum cuts neede... | ```python
class Solution:
def minCut(self, s: str) -> int:
n = len(s)
if n == 0:
return 0
# dp array to store the minimum cuts needed for the first i characters
dp = [float('inf')] * n
# Iterate over each character in the string
for i in ... |
gas-station | 134 | Medium | [
"Greedy",
"Array"
] | There are n gas stations along a circular route, where the amount of gas at the ith station is gas[i].
You have a car with an unlimited gas tank and it costs cost[i] of gas to travel from the ith station to its next (i + 1)th station. You begin the journey with an empty tank at one of the gas stations.
Given two intege... | class Solution:
def canCompleteCircuit(self, gas: List[int], cost: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def canCompleteCircuit(self, gas: List[int], cost: List[int]) -> int:
n = len(gas)
i = j = n - 1
cnt = s = 0
while cnt < n:
s += gas[j] - cost[j]
cnt += 1
j = (j + 1) % n
while s < 0 and cnt < n:
i -= 1
... | Solution().canCompleteCircuit | def check(candidate):
assert candidate(gas = [1, 2, 3, 4, 5],cost = [3, 4, 5, 1, 2]) == 3
assert candidate(gas = [1, 1, 1, 1],cost = [1, 1, 1, 1]) == 3
assert candidate(gas = [1, 1, 1, 1, 1],cost = [1, 1, 1, 1, 1]) == 4
assert candidate(gas = [5, 1, 2, 3, 4],cost = [4, 5, 1, 2, 3]) == 2
assert candi... | [
{
"input": "gas = [1,2,3,4,5], cost = [3,4,5,1,2]",
"output": "3"
},
{
"input": "gas = [1,1,1,1], cost = [1,1,1,1]",
"output": "3"
},
{
"input": "gas = [1,1,1,1,1], cost = [1,1,1,1,1]",
"output": "4"
},
{
"input": "gas = [5,1,2,3,4], cost = [4,5,1,2,3]",
"output": "2"
}... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
There are n gas stations along a circular route, where the amount of gas at the ith station is gas[i].
You have a car w... | ```python
class Solution:
def canCompleteCircuit(self, gas: List[int], cost: List[int]) -> int:
n = len(gas)
i = j = n - 1
cnt = s = 0
while cnt < n:
s += gas[j] - cost[j]
cnt += 1
j = (j + 1) % n
while s < 0 and cnt < n:
... |
candy | 135 | Hard | [
"Greedy",
"Array"
] | There are n children standing in a line. Each child is assigned a rating value given in the integer array ratings.
You are giving candies to these children subjected to the following requirements:
Each child must have at least one candy.
Children with a higher rating get more candies than their neighbors.
Return the ... | class Solution:
def candy(self, ratings: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def candy(self, ratings: List[int]) -> int:
n = len(ratings)
left = [1] * n
right = [1] * n
for i in range(1, n):
if ratings[i] > ratings[i - 1]:
left[i] = left[i - 1] + 1
for i in range(n - 2, -1, -1):
if ratings[i] > r... | Solution().candy | def check(candidate):
assert candidate(ratings = [50, 40, 30, 20, 10]) == 15
assert candidate(ratings = [1]) == 1
assert candidate(ratings = [1, 3, 4, 5, 2]) == 11
assert candidate(ratings = [1, 1, 1, 1]) == 4
assert candidate(ratings = [1, 2, 3, 2, 1, 2, 3, 4, 3, 2, 1]) == 24
assert candidate(r... | [
{
"input": "ratings = [50,40,30,20,10]",
"output": "15"
},
{
"input": "ratings = [1]",
"output": "1"
},
{
"input": "ratings = [1,3,4,5,2]",
"output": "11"
},
{
"input": "ratings = [1,1,1,1]",
"output": "4"
},
{
"input": "ratings = [1,2,3,2,1,2,3,4,3,2,1]",
"ou... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
There are n children standing in a line. Each child is assigned a rating value given in the integer array ratings.
You ... | ```python
from typing import List
class Solution:
def candy(self, ratings: List[int]) -> int:
n = len(ratings)
if n == 1:
return 1
# Initialize candies array with 1 candy for each child
candies = [1] * n
# Traverse the ratings from left to right... |
single-number | 136 | Easy | [
"Bit Manipulation",
"Array"
] | Given a non-empty array of integers nums, every element appears twice except for one. Find that single one.
You must implement a solution with a linear runtime complexity and use only constant extra space.
Example 1:
Input: nums = [2,2,1]
Output: 1
Example 2:
Input: nums = [4,1,2,1,2]
Output: 4
Example 3:
Input:... | class Solution:
def singleNumber(self, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def singleNumber(self, nums: List[int]) -> int:
return reduce(xor, nums)
| Solution().singleNumber | def check(candidate):
assert candidate(nums = [-1, 2, -1, -2, 2]) == -2
assert candidate(nums = [1]) == 1
assert candidate(nums = [10, 1, 10, 2, 2]) == 1
assert candidate(nums = [3, 3, 7, 7, 10]) == 10
assert candidate(nums = [10, 10, 20, 20, 30]) == 30
assert candidate(nums = [3, 3, 5, 7, 5, 7,... | [
{
"input": "nums = [-1,2,-1,-2,2]",
"output": "-2"
},
{
"input": "nums = [1]",
"output": "1"
},
{
"input": "nums = [10,1,10,2,2]",
"output": "1"
},
{
"input": "nums = [3,3,7,7,10]",
"output": "10"
},
{
"input": "nums = [10,10,20,20,30]",
"output": "30"
},
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a non-empty array of integers nums, every element appears twice except for one. Find that single one.
You must im... | ```python
from typing import List
class Solution:
def singleNumber(self, nums: List[int]) -> int:
# Using XOR to find the single number
single = 0
for num in nums:
single ^= num
return single
```
### Explanation:
The solution uses the XOR bitwise operation to find the s... |
single-number-ii | 137 | Medium | [
"Bit Manipulation",
"Array"
] | Given an integer array nums where every element appears three times except for one, which appears exactly once. Find the single element and return it.
You must implement a solution with a linear runtime complexity and use only constant extra space.
Example 1:
Input: nums = [2,2,3,2]
Output: 3
Example 2:
Input: nums =... | class Solution:
def singleNumber(self, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def singleNumber(self, nums: List[int]) -> int:
ans = 0
for i in range(32):
cnt = sum(num >> i & 1 for num in nums)
if cnt % 3:
if i == 31:
ans -= 1 << i
else:
ans |= 1 << i
return... | Solution().singleNumber | def check(candidate):
assert candidate(nums = [1000000000, 1000000000, 1000000000, 7]) == 7
assert candidate(nums = [-1, -1, -1, 100]) == 100
assert candidate(nums = [-2, -2, -2, 1]) == 1
assert candidate(nums = [1000000, 1000000, 1000000, 2000000]) == 2000000
assert candidate(nums = [1, 1, 1, 2, 2,... | [
{
"input": "nums = [1000000000,1000000000,1000000000,7]",
"output": "7"
},
{
"input": "nums = [-1,-1,-1,100]",
"output": "100"
},
{
"input": "nums = [-2,-2,-2,1]",
"output": "1"
},
{
"input": "nums = [1000000,1000000,1000000,2000000]",
"output": "2000000"
},
{
"in... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer array nums where every element appears three times except for one, which appears exactly once. Find th... | ```python
class Solution:
def singleNumber(self, nums: List[int]) -> int:
ans = 0
for i in range(32):
cnt = sum(num >> i & 1 for num in nums)
if cnt % 3:
if i == 31:
ans -= 1 << i
else:
ans |= 1 << i
... |
word-break | 139 | Medium | [
"Trie",
"Memoization",
"Array",
"Hash Table",
"String",
"Dynamic Programming"
] | Given a string s and a dictionary of strings wordDict, return true if s can be segmented into a space-separated sequence of one or more dictionary words.
Note that the same word in the dictionary may be reused multiple times in the segmentation.
Example 1:
Input: s = "leetcode", wordDict = ["leet","code"]
Output: tr... | class Solution:
def wordBreak(self, s: str, wordDict: List[str]) -> bool:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def wordBreak(self, s: str, wordDict: List[str]) -> bool:
words = set(wordDict)
n = len(s)
f = [True] + [False] * n
for i in range(1, n + 1):
f[i] = any(f[j] and s[j:i] in words for j in range(i))
return f[n]
| Solution().wordBreak | def check(candidate):
assert candidate(s = "cars",wordDict = ['car', 'ca', 'rs']) == True
assert candidate(s = "goals",wordDict = ['go', 'goal', 'goals']) == True
assert candidate(s = "pineapplepenapple",wordDict = ['apple', 'pen', 'applepen', 'pine', 'pineapple']) == True
assert candidate(s = "leetcode... | [
{
"input": "s = \"cars\", wordDict = [\"car\",\"ca\",\"rs\"]",
"output": "True"
},
{
"input": "s = \"goals\", wordDict = [\"go\",\"goal\",\"goals\"]",
"output": "True"
},
{
"input": "s = \"pineapplepenapple\", wordDict = [\"apple\",\"pen\",\"applepen\",\"pine\",\"pineapple\"]",
"outp... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a string s and a dictionary of strings wordDict, return true if s can be segmented into a space-separated sequenc... | ```python
from typing import List
class Solution:
def wordBreak(self, s: str, wordDict: List[str]) -> bool:
word_set = set(wordDict)
dp = [False] * (len(s) + 1)
dp[0] = True # Base case: empty string can be segmented
for i in range(1, len(s) + 1):
for j in rang... |
word-break-ii | 140 | Hard | [
"Trie",
"Memoization",
"Array",
"Hash Table",
"String",
"Dynamic Programming",
"Backtracking"
] | Given a string s and a dictionary of strings wordDict, add spaces in s to construct a sentence where each word is a valid dictionary word. Return all such possible sentences in any order.
Note that the same word in the dictionary may be reused multiple times in the segmentation.
Example 1:
Input: s = "catsanddog", w... | class Solution:
def wordBreak(self, s: str, wordDict: List[str]) -> List[str]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Trie:
def __init__(self):
self.children = [None] * 26
self.is_end = False
def insert(self, word):
node = self
for c in word:
idx = ord(c) - ord('a')
if node.children[idx] is None:
node.children[idx] = Trie()
node = node.c... | Solution().wordBreak | def check(candidate):
assert candidate(s = "aaaaaaa",wordDict = ['aa', 'aaa']) == ['aa aa aaa', 'aa aaa aa', 'aaa aa aa']
assert candidate(s = "pineapplepenapple",wordDict = ['apple', 'pen', 'applepen', 'pine', 'pineapple']) == ['pine apple pen apple', 'pine applepen apple', 'pineapple pen apple']
assert ca... | [
{
"input": "s = \"aaaaaaa\", wordDict = [\"aa\",\"aaa\"]",
"output": "['aa aa aaa', 'aa aaa aa', 'aaa aa aa']"
},
{
"input": "s = \"pineapplepenapple\", wordDict = [\"apple\",\"pen\",\"applepen\",\"pine\",\"pineapple\"]",
"output": "['pine apple pen apple', 'pine applepen apple', 'pineapple pen ... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a string s and a dictionary of strings wordDict, add spaces in s to construct a sentence where each word is a val... | ```python
from typing import List
class Solution:
def wordBreak(self, s: str, wordDict: List[str]) -> List[str]:
wordSet = set(wordDict)
memo = {}
def dfs(start):
if start in memo:
return memo[start]
if start == len(s):
return... |
linked-list-cycle | 141 | Easy | [
"Hash Table",
"Linked List",
"Two Pointers"
] | Given head, the head of a linked list, determine if the linked list has a cycle in it.
There is a cycle in a linked list if there is some node in the list that can be reached again by continuously following the next pointer. Internally, pos is used to denote the index of the node that tail's next pointer is connected t... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, x):
# self.val = x
# self.next = None
class Solution:
def hasCycle(self, head: Optional[ListNode]) -> bool:
| 2015-08-07T00:00:00 | import heapq
import itertools
from sortedcontainers import SortedList
import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, x):
# self.val = x
# self.next = None
class Solution:
def hasCycle(self, head: Optional[ListNode]) -> bool:
s = set()
while head:
if head in s:
return True
s.add(... | Solution().hasCycle | def check(candidate):
assert candidate(head = list_node([1, 2])) == False
assert candidate(head = list_node([1])) == False
assert candidate(head = list_node([])) == False
assert candidate(head = list_node([1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1])) == False
assert candidate(head = list_node([3, 2, 0, -4]))... | [
{
"input": "head = [3,2,0,-4], pos = 1",
"output": "Error: Solution.hasCycle() got an unexpected keyword argument 'pos'"
},
{
"input": "head = [1,2,3,4,5], pos = 2",
"output": "Error: Solution.hasCycle() got an unexpected keyword argument 'pos'"
},
{
"input": "head = [], pos = -1",
"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given head, the head of a linked list, determine if the linked list has a cycle in it.
There is a cycle in a linked lis... | ```python
# Definition for singly-linked list.
# class ListNode:
# def __init__(self, x):
# self.val = x
# self.next = None
class Solution:
def hasCycle(self, head: Optional[ListNode]) -> bool:
if not head or not head.next:
return False
slow = head
f... |
reorder-list | 143 | Medium | [
"Stack",
"Recursion",
"Linked List",
"Two Pointers"
] | You are given the head of a singly linked-list. The list can be represented as:
L0 → L1 → … → Ln - 1 → Ln
Reorder the list to be on the following form:
L0 → Ln → L1 → Ln - 1 → L2 → Ln - 2 → …
You may not modify the values in the list's nodes. Only nodes themselves may be changed.
Example 1:
Input: head = [1,2,3... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def reorderList(self, head: Optional[ListNode]) -> None:
"""
Do not return anything, modify head in-place instead.
"""
... | 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def reorderList(self, head: Optional[ListNode]) -> None:
fast = slow = head
while fast.next and fast.next.next:
slow = sl... | Solution().reorderList | def check(candidate):
assert candidate(head = list_node([1, 2, 3])) == None
assert candidate(head = list_node([1, 2, 3, 4, 5])) == None
assert candidate(head = list_node([1])) == None
assert candidate(head = list_node([1, 2])) == None
assert candidate(head = list_node([1, 2, 3, 4, 5, 6, 7, 8, 9, 10]... | [
{
"input": "head = [1,2,3]",
"output": "None"
},
{
"input": "head = [1,2,3,4,5]",
"output": "None"
},
{
"input": "head = [1]",
"output": "None"
},
{
"input": "head = [1,2]",
"output": "None"
},
{
"input": "head = [1,2,3,4,5,6,7,8,9,10]",
"output": "None"
},
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given the head of a singly linked-list. The list can be represented as:
L0 → L1 → … → Ln - 1 → Ln
Reorder the... | ```python
# Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def reorderList(self, head: Optional[ListNode]) -> None:
"""
Do not return anything, modify head in-place instead.
... |
binary-tree-preorder-traversal | 144 | Easy | [
"Stack",
"Tree",
"Depth-First Search",
"Binary Tree"
] | Given the root of a binary tree, return the preorder traversal of its nodes' values.
Example 1:
Input: root = [1,null,2,3]
Output: [1,2,3]
Explanation:
Example 2:
Input: root = [1,2,3,4,5,null,8,null,null,6,7,9]
Output: [1,2,4,5,6,7,3,8,9]
Explanation:
Example 3:
Input: root = []
Output: []
Example 4:
Input:... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def preorderTraversal(self, root: Optional[TreeNode]) -> List[int]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def preorderTraversal(self, root: Optional[TreeNode]) -> List[int]:
def dfs(root):
if ro... | Solution().preorderTraversal | def check(candidate):
assert candidate(root = tree_node([1, 2, 3, None, 4, None, 5])) == [1, 2, 4, 3, 5]
assert candidate(root = tree_node([1, None, None])) == [1]
assert candidate(root = tree_node([1, 2, 3, 4, 5, None, 8, None, None, 6, 7, 9])) == [1, 2, 4, 5, 6, 7, 3, 8, 9]
assert candidate(root = tre... | [
{
"input": "root = [1,2,3,null,4,null,5]",
"output": "[1, 2, 4, 3, 5]"
},
{
"input": "root = [1,null,null]",
"output": "[1]"
},
{
"input": "root = [1,2,3,4,5,null,8,null,null,6,7,9]",
"output": "[1, 2, 4, 5, 6, 7, 3, 8, 9]"
},
{
"input": "root = [1,null,3,null,2]",
"outpu... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree, return the preorder traversal of its nodes' values.
Example 1:
Input: root = [1,nul... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def preorderTraversal(self, root: Optional[TreeNode]) -> List[int]:
if root is None:
... |
binary-tree-postorder-traversal | 145 | Easy | [
"Stack",
"Tree",
"Depth-First Search",
"Binary Tree"
] | Given the root of a binary tree, return the postorder traversal of its nodes' values.
Example 1:
Input: root = [1,null,2,3]
Output: [3,2,1]
Explanation:
Example 2:
Input: root = [1,2,3,4,5,null,8,null,null,6,7,9]
Output: [4,6,7,5,2,9,8,3,1]
Explanation:
Example 3:
Input: root = []
Output: []
Example 4:
Input... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def postorderTraversal(self, root: Optional[TreeNode]) -> List[int]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def postorderTraversal(self, root: Optional[TreeNode]) -> List[int]:
def dfs(root):
if r... | Solution().postorderTraversal | def check(candidate):
assert candidate(root = tree_node([2, None, 1])) == [1, 2]
assert candidate(root = tree_node([1, 2, 3, 4, 5, None, 8, None, None, 6, 7, 9])) == [4, 6, 7, 5, 2, 9, 8, 3, 1]
assert candidate(root = tree_node([1, 2])) == [2, 1]
assert candidate(root = tree_node([1, None, 2, 3])) == [3... | [
{
"input": "root = [2,null,1]",
"output": "[1, 2]"
},
{
"input": "root = [1,2,3,4,5,null,8,null,null,6,7,9]",
"output": "[4, 6, 7, 5, 2, 9, 8, 3, 1]"
},
{
"input": "root = [1,2]",
"output": "[2, 1]"
},
{
"input": "root = [1,null,2,3]",
"output": "[3, 2, 1]"
},
{
"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree, return the postorder traversal of its nodes' values.
Example 1:
Input: root = [1,nu... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def postorderTraversal(self, root: Optional[TreeNode]) -> List[int]:
if not root:
... |
insertion-sort-list | 147 | Medium | [
"Linked List",
"Sorting"
] | Given the head of a singly linked list, sort the list using insertion sort, and return the sorted list's head.
The steps of the insertion sort algorithm:
Insertion sort iterates, consuming one input element each repetition and growing a sorted output list.
At each iteration, insertion sort removes one element from the... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def insertionSortList(self, head: Optional[ListNode]) -> Optional[ListNode]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def insertionSortList(self, head: ListNode) -> ListNode:
if head is None or head.next is None:
return head
dummy = ListNo... | Solution().insertionSortList | def check(candidate):
assert is_same_list(candidate(head = list_node([5, 4, 3, 2, 1])), list_node([1, 2, 3, 4, 5]))
assert is_same_list(candidate(head = list_node([1, 1, 1, 1, 1, 1, 1, 1, 1, 1])), list_node([1, 1, 1, 1, 1, 1, 1, 1, 1, 1]))
assert is_same_list(candidate(head = list_node([0, 0, 0, 0])), list_... | [
{
"input": "head = [5,4,3,2,1]",
"output": "[1, 2, 3, 4, 5]"
},
{
"input": "head = [1,1,1,1,1,1,1,1,1,1]",
"output": "[1, 1, 1, 1, 1, 1, 1, 1, 1, 1]"
},
{
"input": "head = [0,0,0,0]",
"output": "[0, 0, 0, 0]"
},
{
"input": "head = [10,-1,0,5,3,2,-5]",
"output": "[-5, -1, ... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the head of a singly linked list, sort the list using insertion sort, and return the sorted list's head.
The step... | ```python
# Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def insertionSortList(self, head: Optional[ListNode]) -> Optional[ListNode]:
if not head or not head.next:
return head
... |
sort-list | 148 | Medium | [
"Linked List",
"Two Pointers",
"Divide and Conquer",
"Sorting",
"Merge Sort"
] | Given the head of a linked list, return the list after sorting it in ascending order.
Example 1:
Input: head = [4,2,1,3]
Output: [1,2,3,4]
Example 2:
Input: head = [-1,5,3,4,0]
Output: [-1,0,3,4,5]
Example 3:
Input: head = []
Output: []
Constraints:
The number of nodes in the list is in the range [0, 5 * 1... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def sortList(self, head: Optional[ListNode]) -> Optional[ListNode]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def sortList(self, head: Optional[ListNode]) -> Optional[ListNode]:
if head is None or head.next is None:
return head
slo... | Solution().sortList | def check(candidate):
assert is_same_list(candidate(head = list_node([1, -1, 2, -2, 3, -3, 4, -4, 5, -5])), list_node([-5, -4, -3, -2, -1, 1, 2, 3, 4, 5]))
assert is_same_list(candidate(head = list_node([5, 4, 3, 2, 1])), list_node([1, 2, 3, 4, 5]))
assert is_same_list(candidate(head = list_node([0, 0, 0, 0... | [
{
"input": "head = [1,-1,2,-2,3,-3,4,-4,5,-5]",
"output": "[-5, -4, -3, -2, -1, 1, 2, 3, 4, 5]"
},
{
"input": "head = [5,4,3,2,1]",
"output": "[1, 2, 3, 4, 5]"
},
{
"input": "head = [0,0,0,0]",
"output": "[0, 0, 0, 0]"
},
{
"input": "head = [-1,5,3,4,0]",
"output": "[-1, ... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the head of a linked list, return the list after sorting it in ascending order.
Example 1:
Input: head = [4,2... | To solve the problem of sorting a linked list in ascending order with a time complexity of O(n log n) and a space complexity of O(1), we can use the merge sort algorithm. Merge sort is well-suited for linked lists because it does not require random access to elements, which is a limitation of linked lists compared to a... |
max-points-on-a-line | 149 | Hard | [
"Geometry",
"Array",
"Hash Table",
"Math"
] | Given an array of points where points[i] = [xi, yi] represents a point on the X-Y plane, return the maximum number of points that lie on the same straight line.
Example 1:
Input: points = [[1,1],[2,2],[3,3]]
Output: 3
Example 2:
Input: points = [[1,1],[3,2],[5,3],[4,1],[2,3],[1,4]]
Output: 4
Constraints:
1 <... | class Solution:
def maxPoints(self, points: List[List[int]]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def maxPoints(self, points: List[List[int]]) -> int:
n = len(points)
ans = 1
for i in range(n):
x1, y1 = points[i]
for j in range(i + 1, n):
x2, y2 = points[j]
cnt = 2
for k in range(j + 1, n):
... | Solution().maxPoints | def check(candidate):
assert candidate(points = [[0, 0], [1, 1], [2, 2], [3, 3], [4, 4], [5, 5]]) == 6
assert candidate(points = [[0, 0], [1, 1], [0, 1], [1, 0]]) == 2
assert candidate(points = [[1, 2], [2, 3], [3, 4], [4, 5], [5, 6], [6, 7]]) == 6
assert candidate(points = [[1, 1], [1, 2], [1, 3], [1, ... | [
{
"input": "points = [[0,0],[1,1],[2,2],[3,3],[4,4],[5,5]]",
"output": "6"
},
{
"input": "points = [[0,0],[1,1],[0,1],[1,0]]",
"output": "2"
},
{
"input": "points = [[1,2],[2,3],[3,4],[4,5],[5,6],[6,7]]",
"output": "6"
},
{
"input": "points = [[1,1],[1,2],[1,3],[1,4]]",
"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an array of points where points[i] = [xi, yi] represents a point on the X-Y plane, return the maximum number of p... | ```python
from typing import List
class Solution:
def maxPoints(self, points: List[List[int]]) -> int:
n = len(points)
ans = 1
for i in range(n):
x1, y1 = points[i]
for j in range(i + 1, n):
x2, y2 = points[j]
cnt = 2
f... |
evaluate-reverse-polish-notation | 150 | Medium | [
"Stack",
"Array",
"Math"
] | You are given an array of strings tokens that represents an arithmetic expression in a Reverse Polish Notation.
Evaluate the expression. Return an integer that represents the value of the expression.
Note that:
The valid operators are '+', '-', '*', and '/'.
Each operand may be an integer or another expression.
The di... | class Solution:
def evalRPN(self, tokens: List[str]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | import operator
class Solution:
def evalRPN(self, tokens: List[str]) -> int:
opt = {
"+": operator.add,
"-": operator.sub,
"*": operator.mul,
"/": operator.truediv,
}
s = []
for token in tokens:
if token in opt:
... | Solution().evalRPN | def check(candidate):
assert candidate(tokens = ['4', '13', '5', '/', '+']) == 6
assert candidate(tokens = ['2', '1', '+', '3', '*']) == 9
assert candidate(tokens = ['10', '6', '9', '3', '+', '-11', '*', '/', '*', '17', '+', '5', '+']) == 22
assert candidate(tokens = ['20', '5', '/', '2', '+', '10', '3'... | [
{
"input": "tokens = [\"4\",\"13\",\"5\",\"/\",\"+\"]",
"output": "6"
},
{
"input": "tokens = [\"2\",\"1\",\"+\",\"3\",\"*\"]",
"output": "9"
},
{
"input": "tokens = [\"10\",\"6\",\"9\",\"3\",\"+\",\"-11\",\"*\",\"/\",\"*\",\"17\",\"+\",\"5\",\"+\"]",
"output": "22"
},
{
"inp... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given an array of strings tokens that represents an arithmetic expression in a Reverse Polish Notation.
Evaluat... | ```python
from typing import List
class Solution:
def evalRPN(self, tokens: List[str]) -> int:
stack = []
operators = {'+', '-', '*', '/'}
for token in tokens:
if token not in operators:
stack.append(int(token))
else:
# Pop th... |
reverse-words-in-a-string | 151 | Medium | [
"Two Pointers",
"String"
] | Given an input string s, reverse the order of the words.
A word is defined as a sequence of non-space characters. The words in s will be separated by at least one space.
Return a string of the words in reverse order concatenated by a single space.
Note that s may contain leading or trailing spaces or multiple spaces be... | class Solution:
def reverseWords(self, s: str) -> str: | 2015-08-07T00:00:00 | import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
| class Solution:
def reverseWords(self, s: str) -> str:
return ' '.join(reversed(s.split()))
| Solution().reverseWords | def check(candidate):
assert candidate(s = "the sky is blue") == "blue is sky the"
assert candidate(s = " hello world ") == "world hello"
assert candidate(s = "a good example") == "example good a"
| [
{
"input": "s = \"the sky is blue\"",
"output": "\"blue is sky the\""
},
{
"input": "s = \" hello world \"",
"output": "\"world hello\""
},
{
"input": "s = \"a good example\"",
"output": "\"example good a\""
},
{
"input": "s = \" multiple spaces between words \"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an input string s, reverse the order of the words.
A word is defined as a sequence of non-space characters. The w... | ```python
class Solution:
def reverseWords(self, s: str) -> str:
# Split the string by spaces and filter out any empty strings
words = s.split()
# Reverse the list of words
words.reverse()
# Join the words with a single space
return ' '.join(words)
```
This solution ... |
maximum-product-subarray | 152 | Medium | [
"Array",
"Dynamic Programming"
] | Given an integer array nums, find a subarray that has the largest product, and return the product.
The test cases are generated so that the answer will fit in a 32-bit integer.
Example 1:
Input: nums = [2,3,-2,4]
Output: 6
Explanation: [2,3] has the largest product 6.
Example 2:
Input: nums = [-2,0,-1]
Output: 0
E... | class Solution:
def maxProduct(self, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def maxProduct(self, nums: List[int]) -> int:
ans = f = g = nums[0]
for x in nums[1:]:
ff, gg = f, g
f = max(x, ff * x, gg * x)
g = min(x, ff * x, gg * x)
ans = max(ans, f)
return ans
| Solution().maxProduct | def check(candidate):
assert candidate(nums = [2, -5, -2, -4, 3]) == 24
assert candidate(nums = [1]) == 1
assert candidate(nums = [-2, 3, -4]) == 24
assert candidate(nums = [10, -20, 0, 5, 1]) == 10
assert candidate(nums = [3, -1, 4]) == 4
assert candidate(nums = [-1, -2, -3, 0]) == 6
assert... | [
{
"input": "nums = [2,-5,-2,-4,3]",
"output": "24"
},
{
"input": "nums = [1]",
"output": "1"
},
{
"input": "nums = [-2,3,-4]",
"output": "24"
},
{
"input": "nums = [10,-20,0,5,1]",
"output": "10"
},
{
"input": "nums = [3,-1,4]",
"output": "4"
},
{
"inp... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer array nums, find a subarray that has the largest product, and return the product.
The test cases are g... | ```python
class Solution:
def maxProduct(self, nums: List[int]) -> int:
if not nums:
return 0
# Initialize the maximum product, minimum product, and result to the first element
max_product = min_product = result = nums[0]
# Iterate through the array star... |
find-minimum-in-rotated-sorted-array | 153 | Medium | [
"Array",
"Binary Search"
] | Suppose an array of length n sorted in ascending order is rotated between 1 and n times. For example, the array nums = [0,1,2,4,5,6,7] might become:
[4,5,6,7,0,1,2] if it was rotated 4 times.
[0,1,2,4,5,6,7] if it was rotated 7 times.
Notice that rotating an array [a[0], a[1], a[2], ..., a[n-1]] 1 time results in the... | class Solution:
def findMin(self, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def findMin(self, nums: List[int]) -> int:
if nums[0] <= nums[-1]:
return nums[0]
left, right = 0, len(nums) - 1
while left < right:
mid = (left + right) >> 1
if nums[0] <= nums[mid]:
left = mid + 1
else:
... | Solution().findMin | def check(candidate):
assert candidate(nums = [4, 5, 6, 7, 0, 1, 2]) == 0
assert candidate(nums = [1]) == 1
assert candidate(nums = [2, 3, 4, 5, 6, 7, 8, 9, 1, 0]) == 1
assert candidate(nums = [1, 3, 2]) == 1
assert candidate(nums = [10, 15, 1, 3, 8]) == 1
assert candidate(nums = [11, 13, 15, 17... | [
{
"input": "nums = [4,5,6,7,0,1,2]",
"output": "0"
},
{
"input": "nums = [1]",
"output": "1"
},
{
"input": "nums = [2,3,4,5,6,7,8,9,1,0]",
"output": "1"
},
{
"input": "nums = [1,3,2]",
"output": "1"
},
{
"input": "nums = [10,15,1,3,8]",
"output": "1"
},
{
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Suppose an array of length n sorted in ascending order is rotated between 1 and n times. For example, the array nums = ... | ```python
class Solution:
def findMin(self, nums: List[int]) -> int:
if nums[0] <= nums[-1]:
return nums[0]
left, right = 0, len(nums) - 1
while left < right:
mid = (left + right) >> 1
if nums[0] <= nums[mid]:
left = mid + 1
els... |
find-minimum-in-rotated-sorted-array-ii | 154 | Hard | [
"Array",
"Binary Search"
] | Suppose an array of length n sorted in ascending order is rotated between 1 and n times. For example, the array nums = [0,1,4,4,5,6,7] might become:
[4,5,6,7,0,1,4] if it was rotated 4 times.
[0,1,4,4,5,6,7] if it was rotated 7 times.
Notice that rotating an array [a[0], a[1], a[2], ..., a[n-1]] 1 time results in the... | class Solution:
def findMin(self, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def findMin(self, nums: List[int]) -> int:
left, right = 0, len(nums) - 1
while left < right:
mid = (left + right) >> 1
if nums[mid] > nums[right]:
left = mid + 1
elif nums[mid] < nums[right]:
right = mid
... | Solution().findMin | def check(candidate):
assert candidate(nums = [0, 0, 1, 1, 2, 2, 3, 3, 4, 4]) == 0
assert candidate(nums = [1, 3, 5]) == 1
assert candidate(nums = [2, 2, 2, 0, 1]) == 0
assert candidate(nums = [5, 1, 2, 3, 4]) == 1
assert candidate(nums = [3, 4, 5, 1, 2]) == 1
assert candidate(nums = [15, 17, 11... | [
{
"input": "nums = [0,0,1,1,2,2,3,3,4,4]",
"output": "0"
},
{
"input": "nums = [1,3,5]",
"output": "1"
},
{
"input": "nums = [2,2,2,0,1]",
"output": "0"
},
{
"input": "nums = [5,1,2,3,4]",
"output": "1"
},
{
"input": "nums = [3,4,5,1,2]",
"output": "1"
},
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Suppose an array of length n sorted in ascending order is rotated between 1 and n times. For example, the array nums = ... | ```python
class Solution:
def findMin(self, nums: List[int]) -> int:
left, right = 0, len(nums) - 1
while left < right:
mid = (left + right) // 2
# If mid element is greater than the rightmost element, the minimum is in the right half
if nums... |
binary-tree-upside-down | 156 | Medium | [
"Tree",
"Depth-First Search",
"Binary Tree"
] | Given the root of a binary tree, turn the tree upside down and return the new root.
You can turn a binary tree upside down with the following steps:
The original left child becomes the new root.
The original root becomes the new right child.
The original right child becomes the new left child.
The mentioned steps ar... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def upsideDownBinaryTree(self, root: Optional[TreeNode]) -> Optional[TreeNode]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def upsideDownBinaryTree(self, root: Optional[TreeNode]) -> Optional[TreeNode]:
if root is None or r... | Solution().upsideDownBinaryTree | def check(candidate):
assert is_same_tree(candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7])), tree_node([4, 5, 2, None, None, 3, 1, 6, 7]))
assert is_same_tree(candidate(root = tree_node([1, 2, 3, 4, 5])), tree_node([4, 5, 2, None, None, 3, 1]))
assert is_same_tree(candidate(root = tree_node([1, 2, 3, None,... | [
{
"input": "root = [1,2,3,4,5,6,7]",
"output": "[4, 5, 2, None, None, 3, 1, 6, 7]"
},
{
"input": "root = [1,2,3,4,5]",
"output": "[4, 5, 2, None, None, 3, 1]"
},
{
"input": "root = [1,2,3,null,null,6,7]",
"output": "[2, 3, 1, 6, 7]"
},
{
"input": "root = [1,2,null,4,5]",
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree, turn the tree upside down and return the new root.
You can turn a binary tree upside d... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def upsideDownBinaryTree(self, root: Optional[TreeNode]) -> Optional[TreeNode]:
if not roo... |
longest-substring-with-at-most-two-distinct-characters | 159 | Medium | [
"Hash Table",
"String",
"Sliding Window"
] | Given a string s, return the length of the longest substring that contains at most two distinct characters.
Example 1:
Input: s = "eceba"
Output: 3
Explanation: The substring is "ece" which its length is 3.
Example 2:
Input: s = "ccaabbb"
Output: 5
Explanation: The substring is "aabbb" which its length is 5.
Co... | class Solution:
def lengthOfLongestSubstringTwoDistinct(self, s: str) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def lengthOfLongestSubstringTwoDistinct(self, s: str) -> int:
cnt = Counter()
ans = j = 0
for i, c in enumerate(s):
cnt[c] += 1
while len(cnt) > 2:
cnt[s[j]] -= 1
if cnt[s[j]] == 0:
cnt.pop(s[j])
... | Solution().lengthOfLongestSubstringTwoDistinct | def check(candidate):
assert candidate(s = "abcdefghijklmnopqrstuvwxyz") == 2
assert candidate(s = "ababccababcc") == 4
assert candidate(s = "aabacbebebe") == 6
assert candidate(s = "a") == 1
assert candidate(s = "abcabcabc") == 2
assert candidate(s = "abcabcabcabc") == 2
assert candidate(s ... | [
{
"input": "s = \"abcdefghijklmnopqrstuvwxyz\"",
"output": "2"
},
{
"input": "s = \"ababccababcc\"",
"output": "4"
},
{
"input": "s = \"aabacbebebe\"",
"output": "6"
},
{
"input": "s = \"a\"",
"output": "1"
},
{
"input": "s = \"abcabcabc\"",
"output": "2"
},... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a string s, return the length of the longest substring that contains at most two distinct characters.
Example 1... | ```python
class Solution:
def lengthOfLongestSubstringTwoDistinct(self, s: str) -> int:
from collections import defaultdict
# Dictionary to store the count of characters in the current window
char_count = defaultdict(int)
left = 0
max_length = 0
for ... |
intersection-of-two-linked-lists | 160 | Easy | [
"Hash Table",
"Linked List",
"Two Pointers"
] | Given the heads of two singly linked-lists headA and headB, return the node at which the two lists intersect. If the two linked lists have no intersection at all, return null.
For example, the following two linked lists begin to intersect at node c1:
The test cases are generated such that there are no cycles anywhere ... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, x):
# self.val = x
# self.next = None
class Solution:
def getIntersectionNode(self, headA: ListNode, headB: ListNode) -> Optional[ListNode]:
| 2015-08-07T00:00:00 | import heapq
import itertools
from sortedcontainers import SortedList
import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, x):
# self.val = x
# self.next = None
class Solution:
def getIntersectionNode(self, headA: ListNode, headB: ListNode) -> ListNode:
a, b = headA, headB
while a != b:
a = a.next if a else head... | Solution().getIntersectionNode | def check(candidate):
assert candidate(headA = list_node([1, 2, 3]),headB = list_node([4, 5, 1, 2, 3])) == None
assert candidate(headA = list_node([3, 6, 9, 12]),headB = list_node([15, 18, 21, 3])) == None
assert candidate(headA = list_node([2, 6, 4]),headB = list_node([1, 5])) == None
assert candidate(... | [
{
"input": "headA = [2,6,4], headB = [1,5], skipA = 3, skipB = 2",
"output": "Error: Solution.getIntersectionNode() got an unexpected keyword argument 'skipA'"
},
{
"input": "headA = [1,9,1,2,4], headB = [3,2,4], skipA = 3, skipB = 1",
"output": "Error: Solution.getIntersectionNode() got an unex... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the heads of two singly linked-lists headA and headB, return the node at which the two lists intersect. If the tw... | ```python
# Definition for singly-linked list.
# class ListNode:
# def __init__(self, x):
# self.val = x
# self.next = None
class Solution:
def getIntersectionNode(self, headA: ListNode, headB: ListNode) -> Optional[ListNode]:
# Initialize two pointers for both lists
pointerA = ... |
one-edit-distance | 161 | Medium | [
"Two Pointers",
"String"
] | Given two strings s and t, return true if they are both one edit distance apart, otherwise return false.
A string s is said to be one distance apart from a string t if you can:
Insert exactly one character into s to get t.
Delete exactly one character from s to get t.
Replace exactly one character of s with a differen... | class Solution:
def isOneEditDistance(self, s: str, t: str) -> bool:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def isOneEditDistance(self, s: str, t: str) -> bool:
if len(s) < len(t):
return self.isOneEditDistance(t, s)
m, n = len(s), len(t)
if m - n > 1:
return False
for i, c in enumerate(t):
if c != s[i]:
return s[i + 1 :] ... | Solution().isOneEditDistance | def check(candidate):
assert candidate(s = "123",t = "1234") == True
assert candidate(s = "abc",t = "abcd") == True
assert candidate(s = "ab",t = "acb") == True
assert candidate(s = "abcd",t = "abde") == False
assert candidate(s = "cat",t = "dog") == False
assert candidate(s = "123",t = "113") =... | [
{
"input": "s = \"123\", t = \"1234\"",
"output": "True"
},
{
"input": "s = \"abc\", t = \"abcd\"",
"output": "True"
},
{
"input": "s = \"ab\", t = \"acb\"",
"output": "True"
},
{
"input": "s = \"abcd\", t = \"abde\"",
"output": "False"
},
{
"input": "s = \"cat\",... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given two strings s and t, return true if they are both one edit distance apart, otherwise return false.
A string s is ... | ```python
class Solution:
def isOneEditDistance(self, s: str, t: str) -> bool:
# Ensure s is the shorter string
if len(s) > len(t):
return self.isOneEditDistance(t, s)
# If the length difference is greater than 1, they can't be one edit distance apart
if len(t) -... |
find-peak-element | 162 | Medium | [
"Array",
"Binary Search"
] | A peak element is an element that is strictly greater than its neighbors.
Given a 0-indexed integer array nums, find a peak element, and return its index. If the array contains multiple peaks, return the index to any of the peaks.
You may imagine that nums[-1] = nums[n] = -∞. In other words, an element is always consid... | class Solution:
def findPeakElement(self, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def findPeakElement(self, nums: List[int]) -> int:
left, right = 0, len(nums) - 1
while left < right:
mid = (left + right) >> 1
if nums[mid] > nums[mid + 1]:
right = mid
else:
left = mid + 1
return left
| Solution().findPeakElement | def check(candidate):
assert candidate(nums = [1, 2, 3, 1]) == 2
assert candidate(nums = [1, 2, 2, 3, 1]) == 3
assert candidate(nums = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10]) == 10
assert candidate(nums = [2, 1]) == 0
assert candidate(nums = [10, 9, 8, 7, 6, 5, 4, 3, 2, 1]) == 0
assert candidate(num... | [
{
"input": "nums = [1,2,3,1]",
"output": "2"
},
{
"input": "nums = [1,2,2,3,1]",
"output": "3"
},
{
"input": "nums = [0,1,2,3,4,5,6,7,8,9,10]",
"output": "10"
},
{
"input": "nums = [2,1]",
"output": "0"
},
{
"input": "nums = [10,9,8,7,6,5,4,3,2,1]",
"output": ... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
A peak element is an element that is strictly greater than its neighbors.
Given a 0-indexed integer array nums, find a ... | ```python
from typing import List
class Solution:
def findPeakElement(self, nums: List[int]) -> int:
left, right = 0, len(nums) - 1
while left < right:
mid = (left + right) // 2
if nums[mid] > nums[mid + 1]:
# If the middle element is gr... |
missing-ranges | 163 | Easy | [
"Array"
] | You are given an inclusive range [lower, upper] and a sorted unique integer array nums, where all elements are within the inclusive range.
A number x is considered missing if x is in the range [lower, upper] and x is not in nums.
Return the shortest sorted list of ranges that exactly covers all the missing numbers. Tha... | class Solution:
def findMissingRanges(self, nums: List[int], lower: int, upper: int) -> List[List[int]]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def findMissingRanges(
self, nums: List[int], lower: int, upper: int
) -> List[List[int]]:
n = len(nums)
if n == 0:
return [[lower, upper]]
ans = []
if nums[0] > lower:
ans.append([lower, nums[0] - 1])
for a, b in pairwise(n... | Solution().findMissingRanges | def check(candidate):
assert candidate(nums = [-1, 0, 1],lower = -2,upper = 2) == [[-2, -2], [2, 2]]
assert candidate(nums = [5, 7, 11, 14],lower = 0,upper = 15) == [[0, 4], [6, 6], [8, 10], [12, 13], [15, 15]]
assert candidate(nums = [1, 2, 3, 4, 5],lower = 1,upper = 5) == []
assert candidate(nums = [0... | [
{
"input": "nums = [-1,0,1], lower = -2, upper = 2",
"output": "[[-2, -2], [2, 2]]"
},
{
"input": "nums = [5,7,11,14], lower = 0, upper = 15",
"output": "[[0, 4], [6, 6], [8, 10], [12, 13], [15, 15]]"
},
{
"input": "nums = [1,2,3,4,5], lower = 1, upper = 5",
"output": "[]"
},
{
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given an inclusive range [lower, upper] and a sorted unique integer array nums, where all elements are within t... | ```python
from typing import List
class Solution:
def findMissingRanges(self, nums: List[int], lower: int, upper: int) -> List[List[int]]:
def add_range(start, end):
if start == end:
missing_ranges.append([start, start])
elif start < end:
missing_rang... |
maximum-gap | 164 | Medium | [
"Array",
"Bucket Sort",
"Radix Sort",
"Sorting"
] | Given an integer array nums, return the maximum difference between two successive elements in its sorted form. If the array contains less than two elements, return 0.
You must write an algorithm that runs in linear time and uses linear extra space.
Example 1:
Input: nums = [3,6,9,1]
Output: 3
Explanation: The sorted... | class Solution:
def maximumGap(self, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def maximumGap(self, nums: List[int]) -> int:
n = len(nums)
if n < 2:
return 0
mi, mx = min(nums), max(nums)
bucket_size = max(1, (mx - mi) // (n - 1))
bucket_count = (mx - mi) // bucket_size + 1
buckets = [[inf, -inf] for _ in range(bucket... | Solution().maximumGap | def check(candidate):
assert candidate(nums = [1, 1000000000]) == 999999999
assert candidate(nums = [8, 10, 58, 59, 9, 29, 90, 1, 7, 2, 45]) == 31
assert candidate(nums = [10, 9, 8, 7, 6, 5, 4, 3, 2, 1]) == 1
assert candidate(nums = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]) == 1
assert candidate(nums = [10])... | [
{
"input": "nums = [1,1000000000]",
"output": "999999999"
},
{
"input": "nums = [8,10,58,59,9,29,90,1,7,2,45]",
"output": "31"
},
{
"input": "nums = [10,9,8,7,6,5,4,3,2,1]",
"output": "1"
},
{
"input": "nums = [1,2,3,4,5,6,7,8,9,10]",
"output": "1"
},
{
"input": "... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer array nums, return the maximum difference between two successive elements in its sorted form. If the a... | To solve the problem in linear time and with linear extra space, we can use the concept of bucket sort. The idea is to distribute the numbers into buckets and then find the maximum gap between the minimum value of the next non-empty bucket and the maximum value of the current bucket.
Here's the implementation:
```pyt... |
compare-version-numbers | 165 | Medium | [
"Two Pointers",
"String"
] | Given two version strings, version1 and version2, compare them. A version string consists of revisions separated by dots '.'. The value of the revision is its integer conversion ignoring leading zeros.
To compare version strings, compare their revision values in left-to-right order. If one of the version strings has fe... | class Solution:
def compareVersion(self, version1: str, version2: str) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def compareVersion(self, version1: str, version2: str) -> int:
m, n = len(version1), len(version2)
i = j = 0
while i < m or j < n:
a = b = 0
while i < m and version1[i] != '.':
a = a * 10 + int(version1[i])
i += 1
... | Solution().compareVersion | def check(candidate):
assert candidate(version1 = "0",version2 = "0.0.0") == 0
assert candidate(version1 = "1.1.1.1",version2 = "1.1.1.1") == 0
assert candidate(version1 = "1.2.3.4",version2 = "1.2.3") == 1
assert candidate(version1 = "1.1.1.1",version2 = "1.1.1") == 1
assert candidate(version1 = "1... | [
{
"input": "version1 = \"0\", version2 = \"0.0.0\"",
"output": "0"
},
{
"input": "version1 = \"1.1.1.1\", version2 = \"1.1.1.1\"",
"output": "0"
},
{
"input": "version1 = \"1.2.3.4\", version2 = \"1.2.3\"",
"output": "1"
},
{
"input": "version1 = \"1.1.1.1\", version2 = \"1.1... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given two version strings, version1 and version2, compare them. A version string consists of revisions separated by dot... | ```python
class Solution:
def compareVersion(self, version1: str, version2: str) -> int:
# Split the version strings by the dot
revisions1 = version1.split('.')
revisions2 = version2.split('.')
# Get the maximum length of the two revision lists
max_length = max(len(r... |
fraction-to-recurring-decimal | 166 | Medium | [
"Hash Table",
"Math",
"String"
] | Given two integers representing the numerator and denominator of a fraction, return the fraction in string format.
If the fractional part is repeating, enclose the repeating part in parentheses.
If multiple answers are possible, return any of them.
It is guaranteed that the length of the answer string is less than 104 ... | class Solution:
def fractionToDecimal(self, numerator: int, denominator: int) -> str:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def fractionToDecimal(self, numerator: int, denominator: int) -> str:
if numerator == 0:
return "0"
ans = []
neg = (numerator > 0) ^ (denominator > 0)
if neg:
ans.append("-")
a, b = abs(numerator), abs(denominator)
ans.append(st... | Solution().fractionToDecimal | def check(candidate):
assert candidate(numerator = 7,denominator = -3) == "-2.(3)"
assert candidate(numerator = 1,denominator = 6) == "0.1(6)"
assert candidate(numerator = 4,denominator = 333) == "0.(012)"
assert candidate(numerator = 22,denominator = 7) == "3.(142857)"
assert candidate(numerator = ... | [
{
"input": "numerator = 7, denominator = -3",
"output": "-2.(3)"
},
{
"input": "numerator = 1, denominator = 6",
"output": "0.1(6)"
},
{
"input": "numerator = 1, denominator = 2147483647",
"output": "Execution timed out"
},
{
"input": "numerator = 4, denominator = 333",
"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given two integers representing the numerator and denominator of a fraction, return the fraction in string format.
If t... | ```python
class Solution:
def fractionToDecimal(self, numerator: int, denominator: int) -> str:
if numerator == 0:
return "0"
# Determine the sign of the result
sign = '-' if (numerator < 0) ^ (denominator < 0) else ''
# Work with absolute values to simp... |
two-sum-ii-input-array-is-sorted | 167 | Medium | [
"Array",
"Two Pointers",
"Binary Search"
] | Given a 1-indexed array of integers numbers that is already sorted in non-decreasing order, find two numbers such that they add up to a specific target number. Let these two numbers be numbers[index1] and numbers[index2] where 1 <= index1 < index2 <= numbers.length.
Return the indices of the two numbers, index1 and ind... | class Solution:
def twoSum(self, numbers: List[int], target: int) -> List[int]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def twoSum(self, numbers: List[int], target: int) -> List[int]:
n = len(numbers)
for i in range(n - 1):
x = target - numbers[i]
j = bisect_left(numbers, x, lo=i + 1)
if j < n and numbers[j] == x:
return [i + 1, j + 1]
| Solution().twoSum | def check(candidate):
assert candidate(numbers = [-3, -2, -1, 0, 0, 1, 2, 3],target = 0) == [1, 8]
assert candidate(numbers = [-10, -5, 0, 5, 10],target = 0) == [1, 5]
assert candidate(numbers = [1, 2, 3, 4, 5, 6, 7, 8, 9],target = 17) == [8, 9]
assert candidate(numbers = [-10, -5, -3, 3, 5, 6, 7, 8, 9]... | [
{
"input": "numbers = [-3,-2,-1,0,0,1,2,3], target = 0",
"output": "[1, 8]"
},
{
"input": "numbers = [-10,-5,0,5,10], target = 0",
"output": "[1, 5]"
},
{
"input": "numbers = [1,2,3,4,5,6,7,8,9], target = 17",
"output": "[8, 9]"
},
{
"input": "numbers = [-10,-5,-3,3,5,6,7,8,9... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a 1-indexed array of integers numbers that is already sorted in non-decreasing order, find two numbers such that ... | ```python
from bisect import bisect_left
from typing import List
class Solution:
def twoSum(self, numbers: List[int], target: int) -> List[int]:
n = len(numbers)
for i in range(n - 1):
x = target - numbers[i]
j = bisect_left(numbers, x, lo=i + 1)
if j < n and num... |
excel-sheet-column-title | 168 | Easy | [
"Math",
"String"
] | Given an integer columnNumber, return its corresponding column title as it appears in an Excel sheet.
For example:
A -> 1
B -> 2
C -> 3
...
Z -> 26
AA -> 27
AB -> 28
...
Example 1:
Input: columnNumber = 1
Output: "A"
Example 2:
Input: columnNumber = 28
Output: "AB"
Example 3:
Input: columnNumber = 701
Output:... | class Solution:
def convertToTitle(self, columnNumber: int) -> str:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def convertToTitle(self, columnNumber: int) -> str:
res = []
while columnNumber:
columnNumber -= 1
res.append(chr(ord('A') + columnNumber % 26))
columnNumber //= 26
return ''.join(res[::-1])
| Solution().convertToTitle | def check(candidate):
assert candidate(columnNumber = 1) == "A"
assert candidate(columnNumber = 28) == "AB"
assert candidate(columnNumber = 1045) == "ANE"
assert candidate(columnNumber = 2147483647) == "FXSHRXW"
assert candidate(columnNumber = 456976) == "YYYZ"
assert candidate(columnNumber = 52... | [
{
"input": "columnNumber = 1",
"output": "A"
},
{
"input": "columnNumber = 28",
"output": "AB"
},
{
"input": "columnNumber = 1045",
"output": "ANE"
},
{
"input": "columnNumber = 2147483647",
"output": "FXSHRXW"
},
{
"input": "columnNumber = 456976",
"output": ... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer columnNumber, return its corresponding column title as it appears in an Excel sheet.
For example:
A -... | ```python
class Solution:
def convertToTitle(self, columnNumber: int) -> str:
result = ""
while columnNumber > 0:
# Convert the current part of the column number to a character
columnNumber, remainder = divmod(columnNumber - 1, 26)
result = chr(65 + remainder) + r... |
majority-element | 169 | Easy | [
"Array",
"Hash Table",
"Divide and Conquer",
"Counting",
"Sorting"
] | Given an array nums of size n, return the majority element.
The majority element is the element that appears more than ⌊n / 2⌋ times. You may assume that the majority element always exists in the array.
Example 1:
Input: nums = [3,2,3]
Output: 3
Example 2:
Input: nums = [2,2,1,1,1,2,2]
Output: 2
Constraints:
n ==... | class Solution:
def majorityElement(self, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def majorityElement(self, nums: List[int]) -> int:
cnt = m = 0
for x in nums:
if cnt == 0:
m, cnt = x, 1
else:
cnt += 1 if m == x else -1
return m
| Solution().majorityElement | def check(candidate):
assert candidate(nums = [1, 1, 2, 2, 2, 2, 2]) == 2
assert candidate(nums = [1, 1, 1, 1, 2, 2, 3]) == 1
assert candidate(nums = [2, 2, 1, 1, 1, 2, 2]) == 2
assert candidate(nums = [-1, 100, -1, -1, -1, -1, 1, 1, 1, 1]) == -1
assert candidate(nums = [1, 2, 3, 4, 5, 4, 4, 4, 4]) ... | [
{
"input": "nums = [1,1,2,2,2,2,2]",
"output": "2"
},
{
"input": "nums = [1,1,1,1,2,2,3]",
"output": "1"
},
{
"input": "nums = [2,2,1,1,1,2,2]",
"output": "2"
},
{
"input": "nums = [-1,100,-1,-1,-1,-1,1,1,1,1]",
"output": "-1"
},
{
"input": "nums = [1,2,3,4,5,4,4,... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an array nums of size n, return the majority element.
The majority element is the element that appears more than ... | ```python
from typing import List
class Solution:
def majorityElement(self, nums: List[int]) -> int:
# Boyer-Moore Voting Algorithm
count = 0
candidate = None
for num in nums:
if count == 0:
candidate = num
count += (1 if num == candi... |
excel-sheet-column-number | 171 | Easy | [
"Math",
"String"
] | Given a string columnTitle that represents the column title as appears in an Excel sheet, return its corresponding column number.
For example:
A -> 1
B -> 2
C -> 3
...
Z -> 26
AA -> 27
AB -> 28
...
Example 1:
Input: columnTitle = "A"
Output: 1
Example 2:
Input: columnTitle = "AB"
Output: 28
Example 3:
Input: ... | class Solution:
def titleToNumber(self, columnTitle: str) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def titleToNumber(self, columnTitle: str) -> int:
ans = 0
for c in map(ord, columnTitle):
ans = ans * 26 + c - ord("A") + 1
return ans
| Solution().titleToNumber | def check(candidate):
assert candidate(columnTitle = "MAD") == 8818
assert candidate(columnTitle = "AAA") == 703
assert candidate(columnTitle = "ZY") == 701
assert candidate(columnTitle = "AC") == 29
assert candidate(columnTitle = "Z") == 26
assert candidate(columnTitle = "ZYZ") == 18252
ass... | [
{
"input": "columnTitle = \"MAD\"",
"output": "8818"
},
{
"input": "columnTitle = \"AAA\"",
"output": "703"
},
{
"input": "columnTitle = \"ZY\"",
"output": "701"
},
{
"input": "columnTitle = \"AC\"",
"output": "29"
},
{
"input": "columnTitle = \"Z\"",
"output"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a string columnTitle that represents the column title as appears in an Excel sheet, return its corresponding colu... | ```python
class Solution:
def titleToNumber(self, columnTitle: str) -> int:
result = 0
for char in columnTitle:
# Convert character to its corresponding number (A=1, B=2, ..., Z=26)
num = ord(char) - ord('A') + 1
# Update result by shifting the current result by 2... |
factorial-trailing-zeroes | 172 | Medium | [
"Math"
] | Given an integer n, return the number of trailing zeroes in n!.
Note that n! = n * (n - 1) * (n - 2) * ... * 3 * 2 * 1.
Example 1:
Input: n = 3
Output: 0
Explanation: 3! = 6, no trailing zero.
Example 2:
Input: n = 5
Output: 1
Explanation: 5! = 120, one trailing zero.
Example 3:
Input: n = 0
Output: 0
Constra... | class Solution:
def trailingZeroes(self, n: int) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def trailingZeroes(self, n: int) -> int:
ans = 0
while n:
n //= 5
ans += n
return ans
| Solution().trailingZeroes | def check(candidate):
assert candidate(n = 0) == 0
assert candidate(n = 3) == 0
assert candidate(n = 10000) == 2499
assert candidate(n = 25) == 6
assert candidate(n = 100) == 24
assert candidate(n = 1000) == 249
assert candidate(n = 10) == 2
assert candidate(n = 5) == 1
assert candid... | [
{
"input": "n = 0",
"output": "0"
},
{
"input": "n = 3",
"output": "0"
},
{
"input": "n = 10000",
"output": "2499"
},
{
"input": "n = 25",
"output": "6"
},
{
"input": "n = 100",
"output": "24"
},
{
"input": "n = 1000",
"output": "249"
},
{
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer n, return the number of trailing zeroes in n!.
Note that n! = n * (n - 1) * (n - 2) * ... * 3 * 2 * 1.... | To solve the problem of finding the number of trailing zeroes in the factorial of a given integer \( n \), we need to understand that trailing zeroes are created by factors of 10 in the number. Since 10 is the product of 2 and 5, and there are always more factors of 2 than 5 in factorials, the number of trailing zeroes... |
dungeon-game | 174 | Hard | [
"Array",
"Dynamic Programming",
"Matrix"
] | The demons had captured the princess and imprisoned her in the bottom-right corner of a dungeon. The dungeon consists of m x n rooms laid out in a 2D grid. Our valiant knight was initially positioned in the top-left room and must fight his way through dungeon to rescue the princess.
The knight has an initial health poi... | class Solution:
def calculateMinimumHP(self, dungeon: List[List[int]]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def calculateMinimumHP(self, dungeon: List[List[int]]) -> int:
m, n = len(dungeon), len(dungeon[0])
dp = [[inf] * (n + 1) for _ in range(m + 1)]
dp[m][n - 1] = dp[m - 1][n] = 1
for i in range(m - 1, -1, -1):
for j in range(n - 1, -1, -1):
d... | Solution().calculateMinimumHP | def check(candidate):
assert candidate(dungeon = [[1, -3, 3], [0, -2, 0], [-3, -3, -3]]) == 3
assert candidate(dungeon = [[-5, -4, -6], [-6, -5, -8], [3, 3, 1]]) == 12
assert candidate(dungeon = [[-2, -3, 3], [-5, -10, 1], [10, 30, -5]]) == 7
assert candidate(dungeon = [[0, 0, 0], [0, 0, 0], [0, 0, 0]])... | [
{
"input": "dungeon = [[1,-3,3],[0,-2,0],[-3,-3,-3]]",
"output": "3"
},
{
"input": "dungeon = [[-5,-4,-6],[-6,-5,-8],[3,3,1]]",
"output": "12"
},
{
"input": "dungeon = [[-2,-3,3],[-5,-10,1],[10,30,-5]]",
"output": "7"
},
{
"input": "dungeon = [[0,0,0],[0,0,0],[0,0,0]]",
"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
The demons had captured the princess and imprisoned her in the bottom-right corner of a dungeon. The dungeon consists o... | ```python
from typing import List
class Solution:
def calculateMinimumHP(self, dungeon: List[List[int]]) -> int:
m, n = len(dungeon), len(dungeon[0])
# Create a 2D list to store the minimum health needed at each cell
dp = [[float('inf')] * (n + 1) for _ in range(m + 1)]
dp[... |
largest-number | 179 | Medium | [
"Greedy",
"Array",
"String",
"Sorting"
] | Given a list of non-negative integers nums, arrange them such that they form the largest number and return it.
Since the result may be very large, so you need to return a string instead of an integer.
Example 1:
Input: nums = [10,2]
Output: "210"
Example 2:
Input: nums = [3,30,34,5,9]
Output: "9534330"
Constrai... | class Solution:
def largestNumber(self, nums: List[int]) -> str:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def largestNumber(self, nums: List[int]) -> str:
nums = [str(v) for v in nums]
nums.sort(key=cmp_to_key(lambda a, b: 1 if a + b < b + a else -1))
return "0" if nums[0] == "0" else "".join(nums)
| Solution().largestNumber | def check(candidate):
assert candidate(nums = [0, 0]) == "0"
assert candidate(nums = [1]) == "1"
assert candidate(nums = [3, 30, 34, 5, 9]) == "9534330"
assert candidate(nums = [10, 2]) == "210"
assert candidate(nums = [111311, 1113]) == "1113111311"
assert candidate(nums = [10, 100, 1000]) == "... | [
{
"input": "nums = [0,0]",
"output": "0"
},
{
"input": "nums = [1]",
"output": "1"
},
{
"input": "nums = [3,30,34,5,9]",
"output": "9534330"
},
{
"input": "nums = [10,2]",
"output": "210"
},
{
"input": "nums = [111311,1113]",
"output": "1113111311"
},
{
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a list of non-negative integers nums, arrange them such that they form the largest number and return it.
Since th... | ```python
from typing import List
class Solution:
def largestNumber(self, nums: List[int]) -> str:
# Convert all integers to strings for comparison
nums_str = list(map(str, nums))
# Sort the numbers based on custom comparator
# We compare two numbers x and y by comparing xy... |
reverse-words-in-a-string-ii | 186 | Medium | [
"Two Pointers",
"String"
] | Given a character array s, reverse the order of the words.
A word is defined as a sequence of non-space characters. The words in s will be separated by a single space.
Your code must solve the problem in-place, i.e. without allocating extra space.
Example 1:
Input: s = ["t","h","e"," ","s","k","y"," ","i","s"," ","b"... | class Solution:
def reverseWords(self, s: List[str]) -> None:
"""
Do not return anything, modify s in-place instead.
"""
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def reverseWords(self, s: List[str]) -> None:
def reverse(i: int, j: int):
while i < j:
s[i], s[j] = s[j], s[i]
i, j = i + 1, j - 1
i, n = 0, len(s)
for j, c in enumerate(s):
if c == " ":
reverse(i, j - ... | Solution().reverseWords | def check(candidate):
assert candidate(s = ['a', 'b', 'c', 'd', 'e', ' ', 'f', 'g', 'h', 'i', 'j', 'k']) == None
assert candidate(s = ['a']) == None
assert candidate(s = ['h', 'e', 'l', 'l', 'o', ' ', 'w', 'o', 'r', 'l', 'd']) == None
assert candidate(s = ['P', 'y', 't', 'h', 'o', 'n', ' ', 'i', 's', ' ... | [
{
"input": "s = [\"a\",\"b\",\"c\",\"d\",\"e\",\" \",\"f\",\"g\",\"h\",\"i\",\"j\",\"k\"]",
"output": "None"
},
{
"input": "s = [\"a\"]",
"output": "None"
},
{
"input": "s = [\"h\",\"e\",\"l\",\"l\",\"o\",\" \",\"w\",\"o\",\"r\",\"l\",\"d\"]",
"output": "None"
},
{
"input": "... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a character array s, reverse the order of the words.
A word is defined as a sequence of non-space characters. The... | ```python
class Solution:
def reverseWords(self, s: List[str]) -> None:
"""
Do not return anything, modify s in-place instead.
"""
# Reverse the entire character array
s.reverse()
# Initialize pointers for reversing each word
start = 0
end = 0... |
repeated-dna-sequences | 187 | Medium | [
"Bit Manipulation",
"Hash Table",
"String",
"Sliding Window",
"Hash Function",
"Rolling Hash"
] | The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.
For example, "ACGAATTCCG" is a DNA sequence.
When studying DNA, it is useful to identify repeated sequences within the DNA.
Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substring... | class Solution:
def findRepeatedDnaSequences(self, s: str) -> List[str]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def findRepeatedDnaSequences(self, s: str) -> List[str]:
cnt = Counter()
ans = []
for i in range(len(s) - 10 + 1):
t = s[i : i + 10]
cnt[t] += 1
if cnt[t] == 2:
ans.append(t)
return ans
| Solution().findRepeatedDnaSequences | def check(candidate):
assert candidate(s = "ACGACGACGACGACGACG") == ['ACGACGACGA', 'CGACGACGAC', 'GACGACGACG']
assert candidate(s = "AAAAAAAAAAAAA") == ['AAAAAAAAAA']
assert candidate(s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT") == ['AAAAACCCCC', 'CCCCCAAAAA']
assert candidate(s = "CGTTGCGTTGCGTTGCGTTG") == ... | [
{
"input": "s = \"ACGACGACGACGACGACG\"",
"output": "['ACGACGACGA', 'CGACGACGAC', 'GACGACGACG']"
},
{
"input": "s = \"AAAAAAAAAAAAA\"",
"output": "['AAAAAAAAAA']"
},
{
"input": "s = \"AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT\"",
"output": "['AAAAACCCCC', 'CCCCCAAAAA']"
},
{
"input": "... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.
For example, "ACGAATTCC... | ```python
from collections import Counter
from typing import List
class Solution:
def findRepeatedDnaSequences(self, s: str) -> List[str]:
cnt = Counter()
ans = []
for i in range(len(s) - 10 + 1):
t = s[i : i + 10]
cnt[t] += 1
if cnt[t] == 2:
... |
best-time-to-buy-and-sell-stock-iv | 188 | Hard | [
"Array",
"Dynamic Programming"
] | You are given an integer array prices where prices[i] is the price of a given stock on the ith day, and an integer k.
Find the maximum profit you can achieve. You may complete at most k transactions: i.e. you may buy at most k times and sell at most k times.
Note: You may not engage in multiple transactions simultaneou... | class Solution:
def maxProfit(self, k: int, prices: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def maxProfit(self, k: int, prices: List[int]) -> int:
@cache
def dfs(i: int, j: int, k: int) -> int:
if i >= len(prices):
return 0
ans = dfs(i + 1, j, k)
if k:
ans = max(ans, prices[i] + dfs(i + 1, j, 0))
... | Solution().maxProfit | def check(candidate):
assert candidate(k = 2,prices = [10, 22, 5, 75, 65, 80]) == 87
assert candidate(k = 5,prices = [1, 2, 3, 4, 5]) == 4
assert candidate(k = 2,prices = [2, 4, 1]) == 2
assert candidate(k = 1,prices = [7, 1, 5, 3, 6, 4]) == 5
assert candidate(k = 1,prices = [3, 3, 3, 3, 3]) == 0
... | [
{
"input": "k = 2, prices = [10,22,5,75,65,80]",
"output": "87"
},
{
"input": "k = 5, prices = [1,2,3,4,5]",
"output": "4"
},
{
"input": "k = 2, prices = [2,4,1]",
"output": "2"
},
{
"input": "k = 1, prices = [7,1,5,3,6,4]",
"output": "5"
},
{
"input": "k = 1, pri... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given an integer array prices where prices[i] is the price of a given stock on the ith day, and an integer k.
F... | ```python
from typing import List
class Solution:
def maxProfit(self, k: int, prices: List[int]) -> int:
if not prices or k == 0:
return 0
n = len(prices)
if k >= n // 2:
# If k is large enough, we can make as many transactions as we want
return ... |
rotate-array | 189 | Medium | [
"Array",
"Math",
"Two Pointers"
] | Given an integer array nums, rotate the array to the right by k steps, where k is non-negative.
Example 1:
Input: nums = [1,2,3,4,5,6,7], k = 3
Output: [5,6,7,1,2,3,4]
Explanation:
rotate 1 steps to the right: [7,1,2,3,4,5,6]
rotate 2 steps to the right: [6,7,1,2,3,4,5]
rotate 3 steps to the right: [5,6,7,1,2,3,4]
... | class Solution:
def rotate(self, nums: List[int], k: int) -> None:
"""
Do not return anything, modify nums in-place instead.
"""
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def rotate(self, nums: List[int], k: int) -> None:
def reverse(i: int, j: int):
while i < j:
nums[i], nums[j] = nums[j], nums[i]
i, j = i + 1, j - 1
n = len(nums)
k %= n
reverse(0, n - 1)
reverse(0, k - 1)
r... | Solution().rotate | def check(candidate):
assert candidate(nums = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10],k = 1) == None
assert candidate(nums = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10],k = 10) == None
assert candidate(nums = [0, 1, 0, 1, 0, 1, 0],k = 2) == None
assert candidate(nums = [1, 2],k = 1) == None
assert candidate(nums = [1, ... | [
{
"input": "nums = [1,2,3,4,5,6,7,8,9,10], k = 1",
"output": "None"
},
{
"input": "nums = [1,2,3,4,5,6,7,8,9,10], k = 10",
"output": "None"
},
{
"input": "nums = [0,1,0,1,0,1,0], k = 2",
"output": "None"
},
{
"input": "nums = [1,2], k = 1",
"output": "None"
},
{
"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer array nums, rotate the array to the right by k steps, where k is non-negative.
Example 1:
Input: nu... | ```python
from typing import List
class Solution:
def rotate(self, nums: List[int], k: int) -> None:
"""
Do not return anything, modify nums in-place instead.
"""
n = len(nums)
k = k % n # In case k is greater than n
# Helper function to reverse a portion o... |
reverse-bits | 190 | Easy | [
"Bit Manipulation",
"Divide and Conquer"
] | Reverse bits of a given 32 bits unsigned integer.
Note:
Note that in some languages, such as Java, there is no unsigned integer type. In this case, both input and output will be given as a signed integer type. They should not affect your implementation, as the integer's internal binary representation is the same, whet... | class Solution:
def reverseBits(self, n: int) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def reverseBits(self, n: int) -> int:
ans = 0
for i in range(32):
ans |= (n & 1) << (31 - i)
n >>= 1
return ans
| Solution().reverseBits | def check(candidate):
assert candidate(n = 0) == 0
assert candidate(n = 11111111111111111111111111111111) == 3817748707
assert candidate(n = 0) == 0
assert candidate(n = 10000000000000000000000000000000) == 1
assert candidate(n = 2147483648) == 1
assert candidate(n = 43261596) == 964176192
a... | [
{
"input": "n = 0",
"output": "0"
},
{
"input": "n = 00000000000000000000000000000001",
"output": "Error: Solution.reverseBits() missing 1 required positional argument: 'n'"
},
{
"input": "n = 11111111111111111111111111111111",
"output": "3817748707"
},
{
"input": "n = 000000... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Reverse bits of a given 32 bits unsigned integer.
Note:
Note that in some languages, such as Java, there is no unsigne... | ```python
class Solution:
def reverseBits(self, n: int) -> int:
# Convert the integer to a binary string, remove the '0b' prefix, and pad with zeros to ensure it's 32 bits
binary_str = format(n, '032b')
# Reverse the binary string
reversed_binary_str = binary_str[::-1]
# Conv... |
number-of-1-bits | 191 | Easy | [
"Bit Manipulation",
"Divide and Conquer"
] | Given a positive integer n, write a function that returns the number of set bits in its binary representation (also known as the Hamming weight).
Example 1:
Input: n = 11
Output: 3
Explanation:
The input binary string 1011 has a total of three set bits.
Example 2:
Input: n = 128
Output: 1
Explanation:
The input bi... | class Solution:
def hammingWeight(self, n: int) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def hammingWeight(self, n: int) -> int:
ans = 0
while n:
n &= n - 1
ans += 1
return ans
| Solution().hammingWeight | def check(candidate):
assert candidate(n = 0) == 0
assert candidate(n = 4095) == 12
assert candidate(n = 11) == 3
assert candidate(n = 15) == 4
assert candidate(n = 2147483647) == 31
assert candidate(n = 32) == 1
assert candidate(n = 1023) == 10
assert candidate(n = 2147483645) == 30
... | [
{
"input": "n = 0",
"output": "0"
},
{
"input": "n = 4095",
"output": "12"
},
{
"input": "n = 11",
"output": "3"
},
{
"input": "n = 15",
"output": "4"
},
{
"input": "n = 2147483647",
"output": "31"
},
{
"input": "n = 32",
"output": "1"
},
{
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a positive integer n, write a function that returns the number of set bits in its binary representation (also kno... | ```python
class Solution:
def hammingWeight(self, n: int) -> int:
# Convert the integer to its binary representation and count the '1's
return bin(n).count('1')
```
This solution converts the integer `n` to its binary representation using Python's built-in `bin()` function, which returns a string p... |
house-robber | 198 | Medium | [
"Array",
"Dynamic Programming"
] | You are a professional robber planning to rob houses along a street. Each house has a certain amount of money stashed, the only constraint stopping you from robbing each of them is that adjacent houses have security systems connected and it will automatically contact the police if two adjacent houses were broken into o... | class Solution:
def rob(self, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def rob(self, nums: List[int]) -> int:
@cache
def dfs(i: int) -> int:
if i >= len(nums):
return 0
return max(nums[i] + dfs(i + 2), dfs(i + 1))
return dfs(0)
| Solution().rob | def check(candidate):
assert candidate(nums = [1]) == 1
assert candidate(nums = [1, 2, 3, 1]) == 4
assert candidate(nums = [2, 1, 1, 2]) == 4
assert candidate(nums = [5, 2, 6, 3, 4, 1]) == 15
assert candidate(nums = [5, 2, 6, 3, 1, 8, 9, 4, 7]) == 28
assert candidate(nums = [1, 2]) == 2
asse... | [
{
"input": "nums = [1]",
"output": "1"
},
{
"input": "nums = [1,2,3,1]",
"output": "4"
},
{
"input": "nums = [2,1,1,2]",
"output": "4"
},
{
"input": "nums = [5,2,6,3,4,1]",
"output": "15"
},
{
"input": "nums = [5,2,6,3,1,8,9,4,7]",
"output": "28"
},
{
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are a professional robber planning to rob houses along a street. Each house has a certain amount of money stashed, ... | ```python
from typing import List
class Solution:
def rob(self, nums: List[int]) -> int:
if not nums:
return 0
if len(nums) == 1:
return nums[0]
# Initialize the dp array
dp = [0] * len(nums)
dp[0] = nums[0]
dp[1] = max(nums[0], nums[... |
binary-tree-right-side-view | 199 | Medium | [
"Tree",
"Depth-First Search",
"Breadth-First Search",
"Binary Tree"
] | Given the root of a binary tree, imagine yourself standing on the right side of it, return the values of the nodes you can see ordered from top to bottom.
Example 1:
Input: root = [1,2,3,null,5,null,4]
Output: [1,3,4]
Explanation:
Example 2:
Input: root = [1,2,3,4,null,null,null,5]
Output: [1,3,4,5]
Explanation:
... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def rightSideView(self, root: Optional[TreeNode]) -> List[int]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def rightSideView(self, root: Optional[TreeNode]) -> List[int]:
ans = []
if root is None:
... | Solution().rightSideView | def check(candidate):
assert candidate(root = tree_node([1, None, 3])) == [1, 3]
assert candidate(root = tree_node([1, 2, 3, 4, None, None, None, 5])) == [1, 3, 4, 5]
assert candidate(root = tree_node([])) == []
assert candidate(root = tree_node([1, 2, 3, None, 5, None, 4])) == [1, 3, 4]
assert cand... | [
{
"input": "root = [1,null,3]",
"output": "[1, 3]"
},
{
"input": "root = [1,2,3,4,null,null,null,5]",
"output": "[1, 3, 4, 5]"
},
{
"input": "root = []",
"output": "[]"
},
{
"input": "root = [1,2,3,null,5,null,4]",
"output": "[1, 3, 4]"
},
{
"input": "root = [1,nu... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree, imagine yourself standing on the right side of it, return the values of the nodes you ... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
from typing import List, Optional
class Solution:
def rightSideView(self, root: Optional[TreeNode]) -> List[int]:... |
number-of-islands | 200 | Medium | [
"Depth-First Search",
"Breadth-First Search",
"Union Find",
"Array",
"Matrix"
] | Given an m x n 2D binary grid grid which represents a map of '1's (land) and '0's (water), return the number of islands.
An island is surrounded by water and is formed by connecting adjacent lands horizontally or vertically. You may assume all four edges of the grid are all surrounded by water.
Example 1:
Input: gri... | class Solution:
def numIslands(self, grid: List[List[str]]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def numIslands(self, grid: List[List[str]]) -> int:
def dfs(i, j):
grid[i][j] = '0'
for a, b in pairwise(dirs):
x, y = i + a, j + b
if 0 <= x < m and 0 <= y < n and grid[x][y] == '1':
dfs(x, y)
ans = 0
... | Solution().numIslands | def check(candidate):
assert candidate(grid = [['1', '1', '1', '1', '0'], ['1', '1', '0', '1', '0'], ['1', '1', '0', '0', '0'], ['0', '0', '0', '0', '0']]) == 1
assert candidate(grid = [['0', '0', '0', '0', '0'], ['0', '0', '0', '0', '0'], ['0', '0', '0', '0', '0'], ['0', '0', '0', '0', '0']]) == 0
assert c... | [
{
"input": "grid = [['1','1','1','1','0'],['1','1','0','1','0'],['1','1','0','0','0'],['0','0','0','0','0']]",
"output": "1"
},
{
"input": "grid = [['0','0','0','0','0'],['0','0','0','0','0'],['0','0','0','0','0'],['0','0','0','0','0']]",
"output": "0"
},
{
"input": "grid = [['1','1','0'... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an m x n 2D binary grid grid which represents a map of '1's (land) and '0's (water), return the number of islands... | ```python
from typing import List
class Solution:
def numIslands(self, grid: List[List[str]]) -> int:
if not grid:
return 0
def dfs(i, j):
# Check for boundary conditions and if the current cell is water
if i < 0 or i >= len(grid) or j < 0 or j >= len(gr... |
bitwise-and-of-numbers-range | 201 | Medium | [
"Bit Manipulation"
] | Given two integers left and right that represent the range [left, right], return the bitwise AND of all numbers in this range, inclusive.
Example 1:
Input: left = 5, right = 7
Output: 4
Example 2:
Input: left = 0, right = 0
Output: 0
Example 3:
Input: left = 1, right = 2147483647
Output: 0
Constraints:
0 <= ... | class Solution:
def rangeBitwiseAnd(self, left: int, right: int) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def rangeBitwiseAnd(self, left: int, right: int) -> int:
while left < right:
right &= right - 1
return right
| Solution().rangeBitwiseAnd | def check(candidate):
assert candidate(left = 5,right = 7) == 4
assert candidate(left = 100,right = 105) == 96
assert candidate(left = 16,right = 31) == 16
assert candidate(left = 123456,right = 654321) == 0
assert candidate(left = 8,right = 12) == 8
assert candidate(left = 0,right = 0) == 0
... | [
{
"input": "left = 5, right = 7",
"output": "4"
},
{
"input": "left = 100, right = 105",
"output": "96"
},
{
"input": "left = 16, right = 31",
"output": "16"
},
{
"input": "left = 123456, right = 654321",
"output": "0"
},
{
"input": "left = 8, right = 12",
"ou... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given two integers left and right that represent the range [left, right], return the bitwise AND of all numbers in this... | ```python
class Solution:
def rangeBitwiseAnd(self, left: int, right: int) -> int:
shift = 0
# Find the common prefix bits
while left < right:
left >>= 1
right >>= 1
shift += 1
# Append zeros to the right
return left << shift
```
This solu... |
happy-number | 202 | Easy | [
"Hash Table",
"Math",
"Two Pointers"
] | Write an algorithm to determine if a number n is happy.
A happy number is a number defined by the following process:
Starting with any positive integer, replace the number by the sum of the squares of its digits.
Repeat the process until the number equals 1 (where it will stay), or it loops endlessly in a cycle which ... | class Solution:
def isHappy(self, n: int) -> bool:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def isHappy(self, n: int) -> bool:
vis = set()
while n != 1 and n not in vis:
vis.add(n)
x = 0
while n:
n, v = divmod(n, 10)
x += v * v
n = x
return n == 1
| Solution().isHappy | def check(candidate):
assert candidate(n = 100) == True
assert candidate(n = 4) == False
assert candidate(n = 20) == False
assert candidate(n = 2) == False
assert candidate(n = 1111111) == True
assert candidate(n = 19) == True
assert candidate(n = 1) == True
assert candidate(n = 10000000... | [
{
"input": "n = 100",
"output": "True"
},
{
"input": "n = 4",
"output": "False"
},
{
"input": "n = 20",
"output": "False"
},
{
"input": "n = 2",
"output": "False"
},
{
"input": "n = 1111111",
"output": "True"
},
{
"input": "n = 19",
"output": "True... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Write an algorithm to determine if a number n is happy.
A happy number is a number defined by the following process:
S... | ```python
class Solution:
def isHappy(self, n: int) -> bool:
def get_next(number):
total_sum = 0
while number > 0:
digit = number % 10
number = number // 10
total_sum += digit * digit
return total_sum
seen =... |
remove-linked-list-elements | 203 | Easy | [
"Recursion",
"Linked List"
] | Given the head of a linked list and an integer val, remove all the nodes of the linked list that has Node.val == val, and return the new head.
Example 1:
Input: head = [1,2,6,3,4,5,6], val = 6
Output: [1,2,3,4,5]
Example 2:
Input: head = [], val = 1
Output: []
Example 3:
Input: head = [7,7,7,7], val = 7
Output:... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def removeElements(self, head: Optional[ListNode], val: int) -> Optional[ListNode]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def removeElements(self, head: ListNode, val: int) -> ListNode:
dummy = ListNode(-1, head)
pre = dummy
while pre.next:
... | Solution().removeElements | def check(candidate):
assert is_same_list(candidate(head = list_node([1, 2, 6, 3, 4, 5, 6]),val = 6), list_node([1, 2, 3, 4, 5]))
assert is_same_list(candidate(head = list_node([10, 20, 30, 40, 50]),val = 10), list_node([20, 30, 40, 50]))
assert is_same_list(candidate(head = list_node([50, 20, 30, 20, 10]),... | [
{
"input": "head = [1,2,6,3,4,5,6], val = 6",
"output": "[1, 2, 3, 4, 5]"
},
{
"input": "head = [10,20,30,40,50], val = 10",
"output": "[20, 30, 40, 50]"
},
{
"input": "head = [50,20,30,20,10], val = 20",
"output": "[50, 30, 10]"
},
{
"input": "head = [1,1,1,1,1], val = 1",
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the head of a linked list and an integer val, remove all the nodes of the linked list that has Node.val == val, a... | ```python
# Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def removeElements(self, head: Optional[ListNode], val: int) -> Optional[ListNode]:
# Create a dummy node that points to the head o... |
count-primes | 204 | Medium | [
"Array",
"Math",
"Enumeration",
"Number Theory"
] | Given an integer n, return the number of prime numbers that are strictly less than n.
Example 1:
Input: n = 10
Output: 4
Explanation: There are 4 prime numbers less than 10, they are 2, 3, 5, 7.
Example 2:
Input: n = 0
Output: 0
Example 3:
Input: n = 1
Output: 0
Constraints:
0 <= n <= 5 * 106
| class Solution:
def countPrimes(self, n: int) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def countPrimes(self, n: int) -> int:
primes = [True] * n
ans = 0
for i in range(2, n):
if primes[i]:
ans += 1
for j in range(i + i, n, i):
primes[j] = False
return ans
| Solution().countPrimes | def check(candidate):
assert candidate(n = 0) == 0
assert candidate(n = 5000000) == 348513
assert candidate(n = 1000) == 168
assert candidate(n = 100) == 25
assert candidate(n = 30) == 10
assert candidate(n = 1500000) == 114155
assert candidate(n = 1000000) == 78498
assert candidate(n = ... | [
{
"input": "n = 0",
"output": "0"
},
{
"input": "n = 5000000",
"output": "348513"
},
{
"input": "n = 1000",
"output": "168"
},
{
"input": "n = 100",
"output": "25"
},
{
"input": "n = 30",
"output": "10"
},
{
"input": "n = 1500000",
"output": "11415... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer n, return the number of prime numbers that are strictly less than n.
Example 1:
Input: n = 10
Outpu... | ```python
class Solution:
def countPrimes(self, n: int) -> int:
if n <= 2:
return 0
# Initialize a list to track prime status of numbers from 0 to n-1
is_prime = [True] * n
is_prime[0] = is_prime[1] = False # 0 and 1 are not prime numbers
# Use ... |
isomorphic-strings | 205 | Easy | [
"Hash Table",
"String"
] | Given two strings s and t, determine if they are isomorphic.
Two strings s and t are isomorphic if the characters in s can be replaced to get t.
All occurrences of a character must be replaced with another character while preserving the order of characters. No two characters may map to the same character, but a charact... | class Solution:
def isIsomorphic(self, s: str, t: str) -> bool:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def isIsomorphic(self, s: str, t: str) -> bool:
d1 = {}
d2 = {}
for a, b in zip(s, t):
if (a in d1 and d1[a] != b) or (b in d2 and d2[b] != a):
return False
d1[a] = b
d2[b] = a
return True
| Solution().isIsomorphic | def check(candidate):
assert candidate(s = "hello",t = "world") == False
assert candidate(s = "abcdefghijklmnopqrstuvwxyz",t = "zyxwvutsrqponmlkjihgfedcba") == True
assert candidate(s = "paper",t = "title") == True
assert candidate(s = "#a@C",t = "%b$D") == True
assert candidate(s = "1234567890",t =... | [
{
"input": "s = \"hello\", t = \"world\"",
"output": "False"
},
{
"input": "s = \"abcdefghijklmnopqrstuvwxyz\", t = \"zyxwvutsrqponmlkjihgfedcba\"",
"output": "True"
},
{
"input": "s = \"paper\", t = \"title\"",
"output": "True"
},
{
"input": "s = \"#a@C\", t = \"%b$D\"",
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given two strings s and t, determine if they are isomorphic.
Two strings s and t are isomorphic if the characters in s ... | ```python
class Solution:
def isIsomorphic(self, s: str, t: str) -> bool:
# Dictionaries to store the mapping of characters from s to t and vice versa
mapping_s_to_t = {}
mapping_t_to_s = {}
# Iterate over the characters of both strings
for char_s, char_t in zip(s, t... |
reverse-linked-list | 206 | Easy | [
"Recursion",
"Linked List"
] | Given the head of a singly linked list, reverse the list, and return the reversed list.
Example 1:
Input: head = [1,2,3,4,5]
Output: [5,4,3,2,1]
Example 2:
Input: head = [1,2]
Output: [2,1]
Example 3:
Input: head = []
Output: []
Constraints:
The number of nodes in the list is the range [0, 5000].
-5000 <= ... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def reverseList(self, head: Optional[ListNode]) -> Optional[ListNode]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def reverseList(self, head: ListNode) -> ListNode:
dummy = ListNode()
curr = head
while curr:
next = curr.next
... | Solution().reverseList | def check(candidate):
assert is_same_list(candidate(head = list_node([5000, -5000, 0, 1000, -1000])), list_node([-1000, 1000, 0, -5000, 5000]))
assert is_same_list(candidate(head = list_node([1, 2, 3, 4, 5])), list_node([5, 4, 3, 2, 1]))
assert candidate(head = list_node([])) == None
assert is_same_list... | [
{
"input": "head = [5000,-5000,0,1000,-1000]",
"output": "[-1000, 1000, 0, -5000, 5000]"
},
{
"input": "head = [1,2,3,4,5]",
"output": "[5, 4, 3, 2, 1]"
},
{
"input": "head = []",
"output": "None"
},
{
"input": "head = [1,2]",
"output": "[2, 1]"
},
{
"input": "hea... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the head of a singly linked list, reverse the list, and return the reversed list.
Example 1:
Input: head = [1... | ```python
# Definition for singly-linked list.
# class ListNode:
# def __init__(self, val=0, next=None):
# self.val = val
# self.next = next
class Solution:
def reverseList(self, head: Optional[ListNode]) -> Optional[ListNode]:
# Iterative approach
prev = None
current = h... |
course-schedule | 207 | Medium | [
"Depth-First Search",
"Breadth-First Search",
"Graph",
"Topological Sort"
] | There are a total of numCourses courses you have to take, labeled from 0 to numCourses - 1. You are given an array prerequisites where prerequisites[i] = [ai, bi] indicates that you must take course bi first if you want to take course ai.
For example, the pair [0, 1], indicates that to take course 0 you have to first ... | class Solution:
def canFinish(self, numCourses: int, prerequisites: List[List[int]]) -> bool:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def canFinish(self, numCourses: int, prerequisites: List[List[int]]) -> bool:
g = [[] for _ in range(numCourses)]
indeg = [0] * numCourses
for a, b in prerequisites:
g[b].append(a)
indeg[a] += 1
q = [i for i, x in enumerate(indeg) if x == 0]
... | Solution().canFinish | def check(candidate):
assert candidate(numCourses = 2,prerequisites = [[1, 0], [0, 1]]) == False
assert candidate(numCourses = 5,prerequisites = [[1, 4], [2, 4], [3, 1], [3, 2]]) == True
assert candidate(numCourses = 4,prerequisites = [[1, 0], [2, 0], [3, 1], [3, 2]]) == True
assert candidate(numCourses... | [
{
"input": "numCourses = 2, prerequisites = [[1,0],[0,1]]",
"output": "False"
},
{
"input": "numCourses = 5, prerequisites = [[1,4],[2,4],[3,1],[3,2]]",
"output": "True"
},
{
"input": "numCourses = 4, prerequisites = [[1,0],[2,0],[3,1],[3,2]]",
"output": "True"
},
{
"input": ... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
There are a total of numCourses courses you have to take, labeled from 0 to numCourses - 1. You are given an array prer... | ```python
from typing import List
class Solution:
def canFinish(self, numCourses: int, prerequisites: List[List[int]]) -> bool:
from collections import defaultdict, deque
# Create a graph
graph = defaultdict(list)
in_degree = [0] * numCourses
# Build the gr... |
minimum-size-subarray-sum | 209 | Medium | [
"Array",
"Binary Search",
"Prefix Sum",
"Sliding Window"
] | Given an array of positive integers nums and a positive integer target, return the minimal length of a subarray whose sum is greater than or equal to target. If there is no such subarray, return 0 instead.
Example 1:
Input: target = 7, nums = [2,3,1,2,4,3]
Output: 2
Explanation: The subarray [4,3] has the minimal le... | class Solution:
def minSubArrayLen(self, target: int, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def minSubArrayLen(self, target: int, nums: List[int]) -> int:
n = len(nums)
s = list(accumulate(nums, initial=0))
ans = n + 1
for i, x in enumerate(s):
j = bisect_left(s, x + target)
if j <= n:
ans = min(ans, j - i)
ret... | Solution().minSubArrayLen | def check(candidate):
assert candidate(target = 8,nums = [1, 2, 3, 4, 5]) == 2
assert candidate(target = 9,nums = [4, 3, 3, 2, 1]) == 3
assert candidate(target = 11,nums = [1, 1, 1, 1, 1, 1, 1, 1]) == 0
assert candidate(target = 100,nums = [10, 20, 30, 40, 50]) == 3
assert candidate(target = 8,nums ... | [
{
"input": "target = 8, nums = [1,2,3,4,5]",
"output": "2"
},
{
"input": "target = 9, nums = [4,3,3,2,1]",
"output": "3"
},
{
"input": "target = 11, nums = [1,1,1,1,1,1,1,1]",
"output": "0"
},
{
"input": "target = 100, nums = [10,20,30,40,50]",
"output": "3"
},
{
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an array of positive integers nums and a positive integer target, return the minimal length of a subarray whose s... | To solve this problem, we can use the sliding window technique to achieve an O(n) time complexity. The idea is to maintain a window that expands to include more elements if the sum is less than the target and contracts if the sum is greater than or equal to the target. This way, we can find the minimal length of a suba... |
course-schedule-ii | 210 | Medium | [
"Depth-First Search",
"Breadth-First Search",
"Graph",
"Topological Sort"
] | There are a total of numCourses courses you have to take, labeled from 0 to numCourses - 1. You are given an array prerequisites where prerequisites[i] = [ai, bi] indicates that you must take course bi first if you want to take course ai.
For example, the pair [0, 1], indicates that to take course 0 you have to first ... | class Solution:
def findOrder(self, numCourses: int, prerequisites: List[List[int]]) -> List[int]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def findOrder(self, numCourses: int, prerequisites: List[List[int]]) -> List[int]:
g = defaultdict(list)
indeg = [0] * numCourses
for a, b in prerequisites:
g[b].append(a)
indeg[a] += 1
ans = []
q = deque(i for i, x in enumerate(indeg) ... | Solution().findOrder | def check(candidate):
assert candidate(numCourses = 4,prerequisites = [[1, 0], [2, 0], [3, 1]]) == [0, 1, 2, 3]
assert candidate(numCourses = 7,prerequisites = [[1, 0], [2, 0], [3, 1], [4, 1], [5, 2], [6, 2]]) == [0, 1, 2, 3, 4, 5, 6]
assert candidate(numCourses = 5,prerequisites = [[1, 0], [2, 0], [3, 1], ... | [
{
"input": "numCourses = 4, prerequisites = [[1,0],[2,0],[3,1]]",
"output": "[0, 1, 2, 3]"
},
{
"input": "numCourses = 7, prerequisites = [[1,0],[2,0],[3,1],[4,1],[5,2],[6,2]]",
"output": "[0, 1, 2, 3, 4, 5, 6]"
},
{
"input": "numCourses = 5, prerequisites = [[1,0],[2,0],[3,1],[3,2],[4,3... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
There are a total of numCourses courses you have to take, labeled from 0 to numCourses - 1. You are given an array prer... | ```python
from collections import defaultdict, deque
from typing import List
class Solution:
def findOrder(self, numCourses: int, prerequisites: List[List[int]]) -> List[int]:
# Create a graph and in-degree array
graph = defaultdict(list)
in_degree = [0] * numCourses
# Buil... |
word-search-ii | 212 | Hard | [
"Trie",
"Array",
"String",
"Backtracking",
"Matrix"
] | Given an m x n board of characters and a list of strings words, return all words on the board.
Each word must be constructed from letters of sequentially adjacent cells, where adjacent cells are horizontally or vertically neighboring. The same letter cell may not be used more than once in a word.
Example 1:
Input: ... | class Solution:
def findWords(self, board: List[List[str]], words: List[str]) -> List[str]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Trie:
def __init__(self):
self.children: List[Trie | None] = [None] * 26
self.ref: int = -1
def insert(self, w: str, ref: int):
node = self
for c in w:
idx = ord(c) - ord('a')
if node.children[idx] is None:
node.children[idx] = Trie(... | Solution().findWords | def check(candidate):
assert candidate(board = [['o', 'a', 'a', 'n'], ['e', 't', 'a', 'e'], ['i', 'h', 'k', 'r'], ['i', 'f', 'l', 'v']],words = ['oath', 'pea', 'eat', 'rain']) == ['oath', 'eat']
assert candidate(board = [['a', 'a']],words = ['a']) == ['a']
assert candidate(board = [['o', 'a', 'a', 'n'], ['e... | [
{
"input": "board = [['o','a','a','n'],['e','t','a','e'],['i','h','k','r'],['i','f','l','v']], words = ['oath','pea','eat','rain']",
"output": "['oath', 'eat']"
},
{
"input": "board = [[\"a\",\"a\"]], words = [\"a\"]",
"output": "['a']"
},
{
"input": "board = [[\"o\",\"a\",\"a\",\"n\"],[... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an m x n board of characters and a list of strings words, return all words on the board.
Each word must be constr... | ```python
from typing import List, Tuple
from itertools import pairwise
class Trie:
def __init__(self):
self.children: List[Trie | None] = [None] * 26
self.ref: int = -1
def insert(self, w: str, ref: int):
node = self
for c in w:
idx = ord(c) - ord('a')
... |
house-robber-ii | 213 | Medium | [
"Array",
"Dynamic Programming"
] | You are a professional robber planning to rob houses along a street. Each house has a certain amount of money stashed. All houses at this place are arranged in a circle. That means the first house is the neighbor of the last one. Meanwhile, adjacent houses have a security system connected, and it will automatically con... | class Solution:
def rob(self, nums: List[int]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def rob(self, nums: List[int]) -> int:
def _rob(nums):
f = g = 0
for x in nums:
f, g = max(f, g), f + x
return max(f, g)
if len(nums) == 1:
return nums[0]
return max(_rob(nums[1:]), _rob(nums[:-1]))
| Solution().rob | def check(candidate):
assert candidate(nums = [1, 2, 3, 1]) == 4
assert candidate(nums = [1, 0, 1, 0, 1]) == 2
assert candidate(nums = [5, 1, 2, 4, 7, 8]) == 14
assert candidate(nums = [5, 3, 1, 1, 1]) == 6
assert candidate(nums = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10]) == 30
assert candidate(nums = [1... | [
{
"input": "nums = [1,2,3,1]",
"output": "4"
},
{
"input": "nums = [1,0,1,0,1]",
"output": "2"
},
{
"input": "nums = [5,1,2,4,7,8]",
"output": "14"
},
{
"input": "nums = [5,3,1,1,1]",
"output": "6"
},
{
"input": "nums = [1,2,3,4,5,6,7,8,9,10]",
"output": "30"
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are a professional robber planning to rob houses along a street. Each house has a certain amount of money stashed. ... | ```python
from typing import List
class Solution:
def rob(self, nums: List[int]) -> int:
if not nums:
return 0
if len(nums) == 1:
return nums[0]
# Helper function to rob a linear sequence of houses
def rob_linear(houses: List[int]) -> int:
... |
shortest-palindrome | 214 | Hard | [
"String",
"String Matching",
"Hash Function",
"Rolling Hash"
] | You are given a string s. You can convert s to a palindrome by adding characters in front of it.
Return the shortest palindrome you can find by performing this transformation.
Example 1:
Input: s = "aacecaaa"
Output: "aaacecaaa"
Example 2:
Input: s = "abcd"
Output: "dcbabcd"
Constraints:
0 <= s.length <= 5 * 104
... | class Solution:
def shortestPalindrome(self, s: str) -> str:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def shortestPalindrome(self, s: str) -> str:
base = 131
mod = 10**9 + 7
n = len(s)
prefix = suffix = 0
mul = 1
idx = 0
for i, c in enumerate(s):
prefix = (prefix * base + (ord(c) - ord('a') + 1)) % mod
suffix = (suffix +... | Solution().shortestPalindrome | def check(candidate):
assert candidate(s = "abcba") == "abcba"
assert candidate(s = "madam") == "madam"
assert candidate(s = "abcdefghijklmnopqrstuvwxyz") == "zyxwvutsrqponmlkjihgfedcbabcdefghijklmnopqrstuvwxyz"
assert candidate(s = "abac") == "cabac"
assert candidate(s = "zxcvbnm") == "mnbvcxzxcvbn... | [
{
"input": "s = \"abcba\"",
"output": "abcba"
},
{
"input": "s = \"madam\"",
"output": "madam"
},
{
"input": "s = \"abcdefghijklmnopqrstuvwxyz\"",
"output": "zyxwvutsrqponmlkjihgfedcbabcdefghijklmnopqrstuvwxyz"
},
{
"input": "s = \"abac\"",
"output": "cabac"
},
{
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given a string s. You can convert s to a palindrome by adding characters in front of it.
Return the shortest pa... | ```python
class Solution:
def shortestPalindrome(self, s: str) -> str:
# Helper function to find the longest palindromic prefix
def longest_palindromic_prefix(s):
n = len(s)
rev_s = s[::-1]
# Create a new string which is s + '#' + reverse of s
new_s = ... |
kth-largest-element-in-an-array | 215 | Medium | [
"Array",
"Divide and Conquer",
"Quickselect",
"Sorting",
"Heap (Priority Queue)"
] | Given an integer array nums and an integer k, return the kth largest element in the array.
Note that it is the kth largest element in the sorted order, not the kth distinct element.
Can you solve it without sorting?
Example 1:
Input: nums = [3,2,1,5,6,4], k = 2
Output: 5
Example 2:
Input: nums = [3,2,3,1,2,4,5,5,6], ... | class Solution:
def findKthLargest(self, nums: List[int], k: int) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def findKthLargest(self, nums: List[int], k: int) -> int:
def quick_sort(l: int, r: int) -> int:
if l == r:
return nums[l]
i, j = l - 1, r + 1
x = nums[(l + r) >> 1]
while i < j:
while 1:
i +=... | Solution().findKthLargest | def check(candidate):
assert candidate(nums = [7, 6, 5, 4, 3, 2, 1],k = 5) == 3
assert candidate(nums = [7, 6, 5, 4, 3, 2, 1],k = 3) == 5
assert candidate(nums = [10000, -10000, 0],k = 2) == 0
assert candidate(nums = [3, 2, 1, 5, 6, 4],k = 2) == 5
assert candidate(nums = [-1, -2, -3, -4, -5],k = 2) ... | [
{
"input": "nums = [7,6,5,4,3,2,1], k = 5",
"output": "3"
},
{
"input": "nums = [7,6,5,4,3,2,1], k = 3",
"output": "5"
},
{
"input": "nums = [10000,-10000,0], k = 2",
"output": "0"
},
{
"input": "nums = [3,2,1,5,6,4], k = 2",
"output": "5"
},
{
"input": "nums = [-... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer array nums and an integer k, return the kth largest element in the array.
Note that it is the kth larg... | To solve the problem of finding the kth largest element in an array without sorting, we can use a min-heap (or priority queue). The idea is to maintain a heap of size k. By iterating through the array, we can ensure that the heap always contains the k largest elements seen so far, with the smallest of these k elements ... |
combination-sum-iii | 216 | Medium | [
"Array",
"Backtracking"
] | Find all valid combinations of k numbers that sum up to n such that the following conditions are true:
Only numbers 1 through 9 are used.
Each number is used at most once.
Return a list of all possible valid combinations. The list must not contain the same combination twice, and the combinations may be returned in an... | class Solution:
def combinationSum3(self, k: int, n: int) -> List[List[int]]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def combinationSum3(self, k: int, n: int) -> List[List[int]]:
def dfs(i: int, s: int):
if s == 0:
if len(t) == k:
ans.append(t[:])
return
if i > 9 or i > s or len(t) >= k:
return
t.append(... | Solution().combinationSum3 | def check(candidate):
assert candidate(k = 7,n = 28) == [[1, 2, 3, 4, 5, 6, 7]]
assert candidate(k = 5,n = 25) == [[1, 2, 5, 8, 9], [1, 2, 6, 7, 9], [1, 3, 4, 8, 9], [1, 3, 5, 7, 9], [1, 3, 6, 7, 8], [1, 4, 5, 6, 9], [1, 4, 5, 7, 8], [2, 3, 4, 7, 9], [2, 3, 5, 6, 9], [2, 3, 5, 7, 8], [2, 4, 5, 6, 8], [3, 4, 5, ... | [
{
"input": "k = 7, n = 28",
"output": "[[1, 2, 3, 4, 5, 6, 7]]"
},
{
"input": "k = 5, n = 25",
"output": "[[1, 2, 5, 8, 9], [1, 2, 6, 7, 9], [1, 3, 4, 8, 9], [1, 3, 5, 7, 9], [1, 3, 6, 7, 8], [1, 4, 5, 6, 9], [1, 4, 5, 7, 8], [2, 3, 4, 7, 9], [2, 3, 5, 6, 9], [2, 3, 5, 7, 8], [2, 4, 5, 6, 8], [3... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Find all valid combinations of k numbers that sum up to n such that the following conditions are true:
Only numbers 1 ... | ```python
from typing import List
class Solution:
def combinationSum3(self, k: int, n: int) -> List[List[int]]:
def backtrack(start, path, target, k):
if k == 0:
if target == 0:
result.append(path)
return
for i in range(start, 10):... |
contains-duplicate | 217 | Easy | [
"Array",
"Hash Table",
"Sorting"
] | Given an integer array nums, return true if any value appears at least twice in the array, and return false if every element is distinct.
Example 1:
Input: nums = [1,2,3,1]
Output: true
Explanation:
The element 1 occurs at the indices 0 and 3.
Example 2:
Input: nums = [1,2,3,4]
Output: false
Explanation:
All eleme... | class Solution:
def containsDuplicate(self, nums: List[int]) -> bool:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def containsDuplicate(self, nums: List[int]) -> bool:
return any(a == b for a, b in pairwise(sorted(nums)))
| Solution().containsDuplicate | def check(candidate):
assert candidate(nums = [1]) == False
assert candidate(nums = [1, 2, 3, 1]) == True
assert candidate(nums = [1, 1, 1, 3, 3, 4, 3, 2, 4, 2]) == True
assert candidate(nums = [0, 0, 0, 0, 0, 0, 0, 0, 0, 0]) == True
assert candidate(nums = [1, 2, 3, 4]) == False
assert candidat... | [
{
"input": "nums = [1]",
"output": "False"
},
{
"input": "nums = [1,2,3,1]",
"output": "True"
},
{
"input": "nums = [1,1,1,3,3,4,3,2,4,2]",
"output": "True"
},
{
"input": "nums = [0,0,0,0,0,0,0,0,0,0]",
"output": "True"
},
{
"input": "nums = [1,2,3,4]",
"outpu... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer array nums, return true if any value appears at least twice in the array, and return false if every el... | ```python
from typing import List
class Solution:
def containsDuplicate(self, nums: List[int]) -> bool:
# Use a set to track seen numbers
seen = set()
for num in nums:
if num in seen:
return True
seen.add(num)
return False
```
This solution u... |
the-skyline-problem | 218 | Hard | [
"Binary Indexed Tree",
"Segment Tree",
"Array",
"Divide and Conquer",
"Ordered Set",
"Line Sweep",
"Heap (Priority Queue)"
] | A city's skyline is the outer contour of the silhouette formed by all the buildings in that city when viewed from a distance. Given the locations and heights of all the buildings, return the skyline formed by these buildings collectively.
The geometric information of each building is given in the array buildings where ... | class Solution:
def getSkyline(self, buildings: List[List[int]]) -> List[List[int]]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | from queue import PriorityQueue
class Solution:
def getSkyline(self, buildings: List[List[int]]) -> List[List[int]]:
skys, lines, pq = [], [], PriorityQueue()
for build in buildings:
lines.extend([build[0], build[1]])
lines.sort()
city, n = 0, len(buildings)
for... | Solution().getSkyline | def check(candidate):
assert candidate(buildings = [[0, 5, 7], [5, 10, 3], [5, 10, 12], [10, 15, 15], [15, 20, 10], [15, 20, 10], [20, 25, 10]]) == [[0, 7], [5, 12], [10, 15], [15, 10], [25, 0]]
assert candidate(buildings = [[1, 2, 1], [1, 2, 2], [1, 2, 3]]) == [[1, 3], [2, 0]]
assert candidate(buildings = ... | [
{
"input": "buildings = [[0,5,7],[5,10,3],[5,10,12],[10,15,15],[15,20,10],[15,20,10],[20,25,10]]",
"output": "[[0, 7], [5, 12], [10, 15], [15, 10], [25, 0]]"
},
{
"input": "buildings = [[1,2,1],[1,2,2],[1,2,3]]",
"output": "[[1, 3], [2, 0]]"
},
{
"input": "buildings = [[0,3,3],[1,5,3],[2... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
A city's skyline is the outer contour of the silhouette formed by all the buildings in that city when viewed from a dis... | To solve the problem of finding the skyline formed by a set of buildings, we need to consider the critical points where the skyline changes, which are the left and right edges of the buildings. We can use a combination of sorting and a max-heap to efficiently process these points and determine the height of the skyline... |
contains-duplicate-ii | 219 | Easy | [
"Array",
"Hash Table",
"Sliding Window"
] | Given an integer array nums and an integer k, return true if there are two distinct indices i and j in the array such that nums[i] == nums[j] and abs(i - j) <= k.
Example 1:
Input: nums = [1,2,3,1], k = 3
Output: true
Example 2:
Input: nums = [1,0,1,1], k = 1
Output: true
Example 3:
Input: nums = [1,2,3,1,2,3], ... | class Solution:
def containsNearbyDuplicate(self, nums: List[int], k: int) -> bool:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def containsNearbyDuplicate(self, nums: List[int], k: int) -> bool:
d = {}
for i, x in enumerate(nums):
if x in d and i - d[x] <= k:
return True
d[x] = i
return False
| Solution().containsNearbyDuplicate | def check(candidate):
assert candidate(nums = [1000000000, -1000000000, 1000000000, -1000000000],k = 2) == True
assert candidate(nums = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10],k = 8) == False
assert candidate(nums = [1, 0, 1, 1],k = 1) == True
assert candidate(nums = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 0],k = 10) ==... | [
{
"input": "nums = [1000000000,-1000000000,1000000000,-1000000000], k = 2",
"output": "True"
},
{
"input": "nums = [1,2,3,4,5,6,7,8,9,10], k = 8",
"output": "False"
},
{
"input": "nums = [1,0,1,1], k = 1",
"output": "True"
},
{
"input": "nums = [0,1,2,3,4,5,6,7,8,9,0], k = 10... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer array nums and an integer k, return true if there are two distinct indices i and j in the array such t... | ```python
from typing import List
class Solution:
def containsNearbyDuplicate(self, nums: List[int], k: int) -> bool:
# Dictionary to store the last seen index of each number
last_seen = {}
for i, num in enumerate(nums):
if num in last_seen and abs(i - last_seen[num]) <... |
contains-duplicate-iii | 220 | Hard | [
"Array",
"Bucket Sort",
"Ordered Set",
"Sorting",
"Sliding Window"
] | You are given an integer array nums and two integers indexDiff and valueDiff.
Find a pair of indices (i, j) such that:
i != j,
abs(i - j) <= indexDiff.
abs(nums[i] - nums[j]) <= valueDiff, and
Return true if such pair exists or false otherwise.
Example 1:
Input: nums = [1,2,3,1], indexDiff = 3, valueDiff = 0
Outpu... | class Solution:
def containsNearbyAlmostDuplicate(self, nums: List[int], indexDiff: int, valueDiff: int) -> bool:
| 2015-08-07T00:00:00 | import heapq
import itertools
from sortedcontainers import SortedList
import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
... | from typing import List
class Solution:
def containsNearbyAlmostDuplicate(self, nums: List[int], indexDiff: int, valueDiff: int) -> bool:
if valueDiff < 0 or indexDiff < 0:
return False
width = valueDiff + 1
buckets = {}
for i, num in enumerate(nums):
bucket_... | Solution().containsNearbyAlmostDuplicate | def check(candidate):
assert candidate(nums = [1, 3, 1, 3, 1, 3],indexDiff = 2,valueDiff = 1) == True
assert candidate(nums = [8, 2, 4, 2, 0, 1, 4, 1, 3],indexDiff = 5,valueDiff = 2) == True
assert candidate(nums = [10, 10, 10, 10, 10, 10],indexDiff = 3,valueDiff = 0) == True
assert candidate(nums = [1,... | [
{
"input": "nums = [1,3,1,3,1,3], indexDiff = 2, valueDiff = 1",
"output": "True"
},
{
"input": "nums = [8,2,4,2,0,1,4,1,3], indexDiff = 5, valueDiff = 2",
"output": "True"
},
{
"input": "nums = [10,10,10,10,10,10], indexDiff = 3, valueDiff = 0",
"output": "True"
},
{
"input"... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given an integer array nums and two integers indexDiff and valueDiff.
Find a pair of indices (i, j) such that:
... | ```python
from sortedcontainers import SortedSet
class Solution:
def containsNearbyAlmostDuplicate(self, nums: List[int], indexDiff: int, valueDiff: int) -> bool:
# This will store the numbers in a sorted order
sorted_set = SortedSet()
for i, num in enumerate(nums):
# F... |
maximal-square | 221 | Medium | [
"Array",
"Dynamic Programming",
"Matrix"
] | Given an m x n binary matrix filled with 0's and 1's, find the largest square containing only 1's and return its area.
Example 1:
Input: matrix = [["1","0","1","0","0"],["1","0","1","1","1"],["1","1","1","1","1"],["1","0","0","1","0"]]
Output: 4
Example 2:
Input: matrix = [["0","1"],["1","0"]]
Output: 1
Example... | class Solution:
def maximalSquare(self, matrix: List[List[str]]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def maximalSquare(self, matrix: List[List[str]]) -> int:
m, n = len(matrix), len(matrix[0])
dp = [[0] * (n + 1) for _ in range(m + 1)]
mx = 0
for i in range(m):
for j in range(n):
if matrix[i][j] == '1':
dp[i + 1][j + 1]... | Solution().maximalSquare | def check(candidate):
assert candidate(matrix = [['0', '1'], ['1', '0']]) == 1
assert candidate(matrix = [['1', '0', '1'], ['1', '1', '0'], ['1', '1', '1']]) == 4
assert candidate(matrix = [['1', '1'], ['1', '1']]) == 4
assert candidate(matrix = [['0']]) == 0
assert candidate(matrix = [['1', '1', '0... | [
{
"input": "matrix = [[\"0\",\"1\"],[\"1\",\"0\"]]",
"output": "1"
},
{
"input": "matrix = [[\"1\",\"0\",\"1\"],[\"1\",\"1\",\"0\"],[\"1\",\"1\",\"1\"]]",
"output": "4"
},
{
"input": "matrix = [[\"1\",\"1\"],[\"1\",\"1\"]]",
"output": "4"
},
{
"input": "matrix = [[\"0\"]]",
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an m x n binary matrix filled with 0's and 1's, find the largest square containing only 1's and return its area.
... | ```python
class Solution:
def maximalSquare(self, matrix: List[List[str]]) -> int:
if not matrix or not matrix[0]:
return 0
m, n = len(matrix), len(matrix[0])
dp = [[0] * (n + 1) for _ in range(m + 1)]
max_side = 0
for i in range(1, m + 1):
... |
count-complete-tree-nodes | 222 | Easy | [
"Bit Manipulation",
"Tree",
"Binary Search",
"Binary Tree"
] | Given the root of a complete binary tree, return the number of the nodes in the tree.
According to Wikipedia, every level, except possibly the last, is completely filled in a complete binary tree, and all nodes in the last level are as far left as possible. It can have between 1 and 2h nodes inclusive at the last level... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def countNodes(self, root: Optional[TreeNode]) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def countNodes(self, root: Optional[TreeNode]) -> int:
if root is None:
return 0
... | Solution().countNodes | def check(candidate):
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7])) == 7
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15])) == 15
assert candidate(root = tree_node([1, 2, 3, 4, 5, None, 7])) == 6
assert candidate(root = tree_node([1, 2, 3, 4, 5, 6])) == 6... | [
{
"input": "root = [1,2,3,4,5,6,7]",
"output": "7"
},
{
"input": "root = [1,2,3,4,5,6,7,8,9,10,11,12,13,14,15]",
"output": "15"
},
{
"input": "root = [1,2,3,4,5,null,7]",
"output": "6"
},
{
"input": "root = [1,2,3,4,5,6]",
"output": "6"
},
{
"input": "root = [1]",... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a complete binary tree, return the number of the nodes in the tree.
According to Wikipedia, every lev... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def countNodes(self, root: Optional[TreeNode]) -> int:
if root is None:
return... |
rectangle-area | 223 | Medium | [
"Geometry",
"Math"
] | Given the coordinates of two rectilinear rectangles in a 2D plane, return the total area covered by the two rectangles.
The first rectangle is defined by its bottom-left corner (ax1, ay1) and its top-right corner (ax2, ay2).
The second rectangle is defined by its bottom-left corner (bx1, by1) and its top-right corner (... | class Solution:
def computeArea(self, ax1: int, ay1: int, ax2: int, ay2: int, bx1: int, by1: int, bx2: int, by2: int) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def computeArea(
self,
ax1: int,
ay1: int,
ax2: int,
ay2: int,
bx1: int,
by1: int,
bx2: int,
by2: int,
) -> int:
a = (ax2 - ax1) * (ay2 - ay1)
b = (bx2 - bx1) * (by2 - by1)
width = min(ax2, bx2) - max... | Solution().computeArea | def check(candidate):
assert candidate(ax1 = -2,ay1 = -2,ax2 = 2,ay2 = 2,bx1 = -2,by1 = -2,bx2 = 2,by2 = 2) == 16
assert candidate(ax1 = 1,ay1 = 1,ax2 = 3,ay2 = 3,bx1 = 2,by1 = 2,bx2 = 4,by2 = 4) == 7
assert candidate(ax1 = 0,ay1 = 0,ax2 = 5,ay2 = 5,bx1 = 5,by1 = 5,bx2 = 10,by2 = 10) == 50
assert candid... | [
{
"input": "ax1 = -2, ay1 = -2, ax2 = 2, ay2 = 2, bx1 = -2, by1 = -2, bx2 = 2, by2 = 2",
"output": "16"
},
{
"input": "ax1 = 1, ay1 = 1, ax2 = 3, ay2 = 3, bx1 = 2, by1 = 2, bx2 = 4, by2 = 4",
"output": "7"
},
{
"input": "ax1 = 0, ay1 = 0, ax2 = 5, ay2 = 5, bx1 = 5, by1 = 5, bx2 = 10, by2... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the coordinates of two rectilinear rectangles in a 2D plane, return the total area covered by the two rectangles.... | ```python
class Solution:
def computeArea(self, ax1: int, ay1: int, ax2: int, ay2: int, bx1: int, by1: int, bx2: int, by2: int) -> int:
# Calculate the area of the first rectangle
area1 = (ax2 - ax1) * (ay2 - ay1)
# Calculate the area of the second rectangle
area2 = (bx2 - b... |
basic-calculator | 224 | Hard | [
"Stack",
"Recursion",
"Math",
"String"
] | Given a string s representing a valid expression, implement a basic calculator to evaluate it, and return the result of the evaluation.
Note: You are not allowed to use any built-in function which evaluates strings as mathematical expressions, such as eval().
Example 1:
Input: s = "1 + 1"
Output: 2
Example 2:
Inpu... | class Solution:
def calculate(self, s: str) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def calculate(self, s: str) -> int:
stk = []
ans, sign = 0, 1
i, n = 0, len(s)
while i < n:
if s[i].isdigit():
x = 0
j = i
while j < n and s[j].isdigit():
x = x * 10 + int(s[j])
... | Solution().calculate | def check(candidate):
assert candidate(s = "30 - (5 + (10 - 15) + 20)") == 10
assert candidate(s = "2147483647") == 2147483647
assert candidate(s = "-2147483647") == -2147483647
assert candidate(s = "- (3 + (2 - 1))") == -4
assert candidate(s = "1 + (2 + 3) + (4 + (5 + 6))") == 21
assert candida... | [
{
"input": "s = \"30 - (5 + (10 - 15) + 20)\"",
"output": "10"
},
{
"input": "s = \"2147483647\"",
"output": "2147483647"
},
{
"input": "s = \"-2147483647\"",
"output": "-2147483647"
},
{
"input": "s = \"- (3 + (2 - 1))\"",
"output": "-4"
},
{
"input": "s = \"1 + ... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a string s representing a valid expression, implement a basic calculator to evaluate it, and return the result of... | ```python
class Solution:
def calculate(self, s: str) -> int:
stk = []
ans, sign = 0, 1
i, n = 0, len(s)
while i < n:
if s[i].isdigit():
x = 0
j = i
while j < n and s[j].isdigit():
x = x * 10 + int(s[j])
... |
invert-binary-tree | 226 | Easy | [
"Tree",
"Depth-First Search",
"Breadth-First Search",
"Binary Tree"
] | Given the root of a binary tree, invert the tree, and return its root.
Example 1:
Input: root = [4,2,7,1,3,6,9]
Output: [4,7,2,9,6,3,1]
Example 2:
Input: root = [2,1,3]
Output: [2,3,1]
Example 3:
Input: root = []
Output: []
Constraints:
The number of nodes in the tree is in the range [0, 100].
-100 <= Node... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def invertTree(self, root: Optional[TreeNode]) -> Optional[TreeNode]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def invertTree(self, root: Optional[TreeNode]) -> Optional[TreeNode]:
if root is None:
r... | Solution().invertTree | def check(candidate):
assert is_same_tree(candidate(root = tree_node([4, 2, 7, 1, 3, 6, 9])), tree_node([4, 7, 2, 9, 6, 3, 1]))
assert is_same_tree(candidate(root = tree_node([2, 1, 3])), tree_node([2, 3, 1]))
assert candidate(root = tree_node([])) == None
assert is_same_tree(candidate(root = tree_node(... | [
{
"input": "root = [4,2,7,1,3,6,9]",
"output": "[4, 7, 2, 9, 6, 3, 1]"
},
{
"input": "root = [2,1,3]",
"output": "[2, 3, 1]"
},
{
"input": "root = []",
"output": "None"
},
{
"input": "root = [3,1,4,null,2]",
"output": "[3, 4, 1, None, None, 2]"
},
{
"input": "root... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary tree, invert the tree, and return its root.
Example 1:
Input: root = [4,2,7,1,3,6,9]
Out... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def invertTree(self, root: Optional[TreeNode]) -> Optional[TreeNode]:
if root is None:
... |
basic-calculator-ii | 227 | Medium | [
"Stack",
"Math",
"String"
] | Given a string s which represents an expression, evaluate this expression and return its value.
The integer division should truncate toward zero.
You may assume that the given expression is always valid. All intermediate results will be in the range of [-231, 231 - 1].
Note: You are not allowed to use any built-in fun... | class Solution:
def calculate(self, s: str) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def calculate(self, s: str) -> int:
v, n = 0, len(s)
sign = '+'
stk = []
for i, c in enumerate(s):
if c.isdigit():
v = v * 10 + int(c)
if i == n - 1 or c in '+-*/':
match sign:
case '+':
... | Solution().calculate | def check(candidate):
assert candidate(s = "2 - 3 + 4") == 3
assert candidate(s = " 1000000000 - 500000000 + 250000000") == 750000000
assert candidate(s = "30 + 2 * 6 / (3 - 1)") == 33
assert candidate(s = "100 * ( 2 + 12 ) / 14") == 200
assert candidate(s = "1 + 1 * 1 + 1") == 3
assert candidat... | [
{
"input": "s = \"2 - 3 + 4\"",
"output": "3"
},
{
"input": "s = \" 1000000000 - 500000000 + 250000000\"",
"output": "750000000"
},
{
"input": "s = \"30 + 2 * 6 / (3 - 1)\"",
"output": "33"
},
{
"input": "s = \"100 * ( 2 + 12 ) / 14\"",
"output": "200"
},
{
"input... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given a string s which represents an expression, evaluate this expression and return its value.
The integer division s... | ```python
class Solution:
def calculate(self, s: str) -> int:
def update(op, num):
if op == '+':
stack.append(num)
elif op == '-':
stack.append(-num)
elif op == '*':
stack.append(stack.pop() * num)
elif op == '/'... |
summary-ranges | 228 | Easy | [
"Array"
] | You are given a sorted unique integer array nums.
A range [a,b] is the set of all integers from a to b (inclusive).
Return the smallest sorted list of ranges that cover all the numbers in the array exactly. That is, each element of nums is covered by exactly one of the ranges, and there is no integer x such that x is i... | class Solution:
def summaryRanges(self, nums: List[int]) -> List[str]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def summaryRanges(self, nums: List[int]) -> List[str]:
def f(i: int, j: int) -> str:
return str(nums[i]) if i == j else f'{nums[i]}->{nums[j]}'
i = 0
n = len(nums)
ans = []
while i < n:
j = i
while j + 1 < n and nums[j + 1]... | Solution().summaryRanges | def check(candidate):
assert candidate(nums = [0, 1, 2, 3, 4, 5]) == ['0->5']
assert candidate(nums = [-1, 0, 1, 2, 3, 5, 6, 7, 8, 10]) == ['-1->3', '5->8', '10']
assert candidate(nums = [-2147483648, -2147483647, -2147483646]) == ['-2147483648->-2147483646']
assert candidate(nums = [1, 3, 5, 7, 9]) == ... | [
{
"input": "nums = [0,1,2,3,4,5]",
"output": "['0->5']"
},
{
"input": "nums = [-1,0,1,2,3,5,6,7,8,10]",
"output": "['-1->3', '5->8', '10']"
},
{
"input": "nums = [-2147483648,-2147483647,-2147483646]",
"output": "['-2147483648->-2147483646']"
},
{
"input": "nums = [1,3,5,7,9]... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
You are given a sorted unique integer array nums.
A range [a,b] is the set of all integers from a to b (inclusive).
Ret... | ```python
class Solution:
def summaryRanges(self, nums: List[int]) -> List[str]:
if not nums:
return []
ranges = []
start = nums[0]
end = nums[0]
for i in range(1, len(nums)):
if nums[i] == nums[i - 1] + 1:
end = nums[... |
majority-element-ii | 229 | Medium | [
"Array",
"Hash Table",
"Counting",
"Sorting"
] | Given an integer array of size n, find all elements that appear more than ⌊ n/3 ⌋ times.
Example 1:
Input: nums = [3,2,3]
Output: [3]
Example 2:
Input: nums = [1]
Output: [1]
Example 3:
Input: nums = [1,2]
Output: [1,2]
Constraints:
1 <= nums.length <= 5 * 104
-109 <= nums[i] <= 109
Follow up: Could you s... | class Solution:
def majorityElement(self, nums: List[int]) -> List[int]:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def majorityElement(self, nums: List[int]) -> List[int]:
n1 = n2 = 0
m1, m2 = 0, 1
for m in nums:
if m == m1:
n1 += 1
elif m == m2:
n2 += 1
elif n1 == 0:
m1, n1 = m, 1
elif n2 == 0... | Solution().majorityElement | def check(candidate):
assert candidate(nums = [3, 2, 3]) == [3]
assert candidate(nums = [1]) == [1]
assert candidate(nums = [1, 2]) == [2, 1]
assert candidate(nums = [1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10]) == []
assert candidate(nums = [1, 2, 3, 4, 5, 6, 7, 8, 9, 1, 1, 1]) ==... | [
{
"input": "nums = [3,2,3]",
"output": "[3]"
},
{
"input": "nums = [1]",
"output": "[1]"
},
{
"input": "nums = [1,2]",
"output": "[2, 1]"
},
{
"input": "nums = [1,2,3,4,5,6,7,8,9,10,1,2,3,4,5,6,7,8,9,10]",
"output": "[]"
},
{
"input": "nums = [1,2,3,4,5,6,7,8,9,1,... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer array of size n, find all elements that appear more than ⌊ n/3 ⌋ times.
Example 1:
Input: nums = [3... | ```python
from typing import List
class Solution:
def majorityElement(self, nums: List[int]) -> List[int]:
n1 = n2 = 0
m1, m2 = 0, 1
for m in nums:
if m == m1:
n1 += 1
elif m == m2:
n2 += 1
elif n1 == 0:
m1,... |
kth-smallest-element-in-a-bst | 230 | Medium | [
"Tree",
"Depth-First Search",
"Binary Search Tree",
"Binary Tree"
] | Given the root of a binary search tree, and an integer k, return the kth smallest value (1-indexed) of all the values of the nodes in the tree.
Example 1:
Input: root = [3,1,4,null,2], k = 1
Output: 1
Example 2:
Input: root = [5,3,6,2,4,null,null,1], k = 3
Output: 3
Constraints:
The number of nodes in the tr... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def kthSmallest(self, root: Optional[TreeNode], k: int) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | # Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def kthSmallest(self, root: Optional[TreeNode], k: int) -> int:
stk = []
while root or stk:
... | Solution().kthSmallest | def check(candidate):
assert candidate(root = tree_node([5, 3, 6, 2, 4, None, None, 1]),k = 3) == 3
assert candidate(root = tree_node([3, 1, 4, None, 2]),k = 1) == 1
assert candidate(root = tree_node([3, 2, 4, 1]),k = 2) == 2
assert candidate(root = tree_node([1]),k = 1) == 1
assert candidate(root =... | [
{
"input": "root = [5,3,6,2,4,null,null,1], k = 3",
"output": "3"
},
{
"input": "root = [3,1,4,null,2], k = 1",
"output": "1"
},
{
"input": "root = [3,2,4,1], k = 2",
"output": "2"
},
{
"input": "root = [1], k = 1",
"output": "1"
},
{
"input": "root = [5,1,7,null,... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given the root of a binary search tree, and an integer k, return the kth smallest value (1-indexed) of all the values o... | ```python
# Definition for a binary tree node.
# class TreeNode:
# def __init__(self, val=0, left=None, right=None):
# self.val = val
# self.left = left
# self.right = right
class Solution:
def kthSmallest(self, root: Optional[TreeNode], k: int) -> int:
stk = []
while roo... |
power-of-two | 231 | Easy | [
"Bit Manipulation",
"Recursion",
"Math"
] | Given an integer n, return true if it is a power of two. Otherwise, return false.
An integer n is a power of two, if there exists an integer x such that n == 2x.
Example 1:
Input: n = 1
Output: true
Explanation: 20 = 1
Example 2:
Input: n = 16
Output: true
Explanation: 24 = 16
Example 3:
Input: n = 3
Output: fal... | class Solution:
def isPowerOfTwo(self, n: int) -> bool:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def isPowerOfTwo(self, n: int) -> bool:
return n > 0 and (n & (n - 1)) == 0
| Solution().isPowerOfTwo | def check(candidate):
assert candidate(n = 3) == False
assert candidate(n = 2097152) == True
assert candidate(n = -16) == False
assert candidate(n = 67108864) == True
assert candidate(n = 4096) == True
assert candidate(n = 2147483647) == False
assert candidate(n = 536870912) == True
asse... | [
{
"input": "n = 3",
"output": "False"
},
{
"input": "n = 2097152",
"output": "True"
},
{
"input": "n = -16",
"output": "False"
},
{
"input": "n = 67108864",
"output": "True"
},
{
"input": "n = 4096",
"output": "True"
},
{
"input": "n = 2147483647",
... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer n, return true if it is a power of two. Otherwise, return false.
An integer n is a power of two, if th... | ```python
class Solution:
def isPowerOfTwo(self, n: int) -> bool:
if n <= 0:
return False
return n & (n - 1) == 0
```
### Explanation:
The solution provided checks if a given integer `n` is a power of two without using loops or recursion. The key insight is based on the binary represent... |
number-of-digit-one | 233 | Hard | [
"Recursion",
"Math",
"Dynamic Programming"
] | Given an integer n, count the total number of digit 1 appearing in all non-negative integers less than or equal to n.
Example 1:
Input: n = 13
Output: 6
Example 2:
Input: n = 0
Output: 0
Constraints:
0 <= n <= 109
| class Solution:
def countDigitOne(self, n: int) -> int:
| 2015-08-07T00:00:00 | import random
import functools
import collections
import string
import math
import datetime
from typing import *
from functools import *
from collections import *
from itertools import *
from heapq import *
from bisect import *
from string import *
from operator import *
from math import *
inf = float('inf')
class L... | class Solution:
def countDigitOne(self, n: int) -> int:
@cache
def dfs(i: int, cnt: int, limit: bool) -> int:
if i >= len(s):
return cnt
up = int(s[i]) if limit else 9
ans = 0
for j in range(up + 1):
ans += dfs(i + 1, cn... | Solution().countDigitOne | def check(candidate):
assert candidate(n = 0) == 0
assert candidate(n = 987654321) == 891632373
assert candidate(n = 100000) == 50001
assert candidate(n = 999999999) == 900000000
assert candidate(n = 999) == 300
assert candidate(n = 1000000) == 600001
assert candidate(n = 501) == 201
ass... | [
{
"input": "n = 0",
"output": "0"
},
{
"input": "n = 987654321",
"output": "891632373"
},
{
"input": "n = 100000",
"output": "50001"
},
{
"input": "n = 999999999",
"output": "900000000"
},
{
"input": "n = 999",
"output": "300"
},
{
"input": "n = 100000... | You are an expert Python programmer. You will be given a question (problem specification) and will generate a correct Python program that matches the specification and passes all tests.
### Question:
Given an integer n, count the total number of digit 1 appearing in all non-negative integers less than or equal to n.
... | ```python
class Solution:
def countDigitOne(self, n: int) -> int:
count = 0
factor = 1
while factor <= n:
lower_nums = n - (n // factor) * factor
cur_num = (n // factor) % 10
higher_nums = n // (factor * 10)
if cur_num == 0:
... |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.