domain stringclasses 17
values | text stringlengths 1.02k 326k | word_count int64 512 512 |
|---|---|---|
s2orc | addresses
L = ⌈(L[^L] * )⌋.(5)
The generic author template A stands for A l and A u . The two are applied sequentially. A three-block layout, for instance, will be
B 3 = ⌈(B s )L{0, 7}(B s )L{0, 7}(B s )⌋.(6)
The set of author A and layout B templates is sufficient to correctly extract an 83% of the authors in the dat... | 512 |
reddit | parents are the only real model of close human interaction I've ever had. I became really worried recently that I, too, am endlessly negative and critical to everyone around me, and that people dislike me and avoid me the same way I want to avoid my mother, because that's how I treat myself internally and that's the o... | 512 |
StackExchange | (.*),
You can also place information inside the capture group so all data up to and including your pattern is extracted.
Q:
Blank Option Text using $(dropdown).append(new Option("Joe Blow", 1, true, true) in IE 9
The following code works correctly in both Chrome and Firefox. In IE 9 the options are appended, but... | 512 |
gmane | ones in IE9. See
difference below:
However the most problematic thing is no change can be applied to the star
in the input box no matter if using for example font "DFKai-SB" in all font
boxes in the Chrome settings. The font used for this input box is
still "Arial Unicode MS".
Conclusion...Chrome suffers fro... | 512 |
StackExchange |
Jan 15 18:58:49 monitor puppet-master[14218]: No fqdn at /etc/puppet/modules/system/manifests/motd.pp:29 on node nodeY
Of course after next puppet agent iteration, everything is fine. I have no idea how to find cause of this issue. Problem is common to all 5 nodes.
I'm 100% sure that it's not related to cron.
A:
I'... | 512 |
reddit | Bring it on. What a band! What a song.
I said after expenses. My expenses in Norway, each month for me, girlfriend and 2 kids was about $6k - $6,5k USD a month. Now in Bulgaria, we all use about half of that altogether, and then add the fact that I only pay 13% and not the low-mid 40's% in tax, t... | 512 |
reddit | them, then I just shoot them without waiting for lock on. It works great for me since Titanfall can get very visually hectic, and pilots move so damn fast its hard to keep track of them.
I have a lot of close friends I do bits with. It's fun. I do improv and sketch comedy as a hobby, but I find this type of bit really... | 512 |
OpenSubtitles | "This might hurt you, Captain." ""m sorry." "Dashing." " Robert." " Thomas." "Captain Shaw." "I was so proud when I heard." "They had no choice." "All the other otticers are dead." " And Forbes?" " lmpossible, as always." "He's here somewhere." "How about you?" "Working tor your tather, helping him with the resettleme... | 512 |
ao3 | hello child
**ShoutNo:** why am i here?
**ShoutNo:** why do i keep getting added to these weird group chats?
**ShoutNo:** why are you pretending to be a villain?
**Dabi:** who the FUCK says im pretending?
**ShoutNo:** Midoriya? Bakugou? Mina? Why
**Dabi:** what the fuck are you talking about
**ShoutNo:** I’m so tired ... | 512 |
realnews | for all meals at restaurants reviewed on this page. Unless specified, the writer does not accept hosted meals prior to the review's publication.
WASHINGTON (Reuters) -
U.S. President Donald Trump offered help to a terminally ill infant an ocean away in a Twitter post on Monday after his parents lost a legal battle to... | 512 |
realnews | contention.
Iran's International Atomic Energy Agency (IAEA) ambassador Ali Asghar Soltanieh gestures as he attends a meeting at the IAEA headquarters in Vienna June 8, 2012. REUTERS/Herwig Prammer
“The Agency must be able to revisit areas as their work progresses and as new information becomes available,” the 27-nati... | 512 |
s2orc | TTTCAGCTTTTATTGCATTTATTAGTTCATTAATATTAATTTAAACATGTAACAATGATGT ATAAATAAAACTGGATGAAGAAATTAGACTAAGTTACCGGTCTTTTCACTTTTAAGTATT AACGCCTGCTTAAACTGTTGCTATTCATTAATTTGTAGTTATTTTTATGTAAATTTTTGCT ATATTATCACAACTTTATATACTGTGCTGGACATGTCAGGTGGAAATGATGGTATCCGTT GTAGACACGACATTGAATGGGCCGGTGTAAAATAAGAGTTCGCCTTTCTTAACATTTAA GATGTGC... | 512 |
StackExchange | }
li.off ul{display:none; }
.linkhover:hover {text-decoration:underline; }
.linkxp:hover {text-decoration:underline; }
#theDiv, #theDiv1, #theDiv2, #theDiv3, #theDiv4, #theDiv5, #theDiv6, #theDiv7, #theDiv8 {
padding:10px;
float:right;
margin:0px 50px 0 0;
width:300px;
height:500px;
border:1px... | 512 |
StackExchange | be plenty strong-enough for the task.
simulate this circuit – Schematic created using CircuitLab
at the top R3 provides C/20 charge current suitable for a 800mAh NiMH cell,
D2 and R4 provide power when ther usb charger is connected, allowing the micrcontroller to operate without using the boost converter.
below that... | 512 |
Pile-CC | the schedule wouldn't be blown.
Where I work, the schedule is determined by the actual developers, and the features are finalized at the beginning of the program. If development stays on schedule, then management doesn't interfere (why interfere if there are no problems?). The conditions you state I'm certain exi
I'... | 512 |
gmane | snmpwalk on it and look through that and it seems that it does not pick up the interfaces either. I am a real newbie to all this all I can say is it was working last week and now it is not. any ideas on how or why this is happening and how to solve it. the only idea I have is to remove the SNMP from the router and add... | 512 |
reddit | staffs and flags in the crowd when I was at bonnaroo...they are really good to spot yourself in videos of the events
Hi! We don't have a P.O box set up, and players wouldn't feel comfortable having their address put out in the public. I can't say it's possible to send something at this exact moment, your b... | 512 |
reddit | n vertices as part of their job very false try harder to find what actually motivates your students and the math behind it... for instance you think someone can work on building a self-driving car without understanding linear algebra?
Ugh! I can put that dumb cunt into place if you need me to...I'm def s... | 512 |
YouTubeCommons | now so after 317 we will commit to inflate the amount of hairstyle that we have right now and so many other details like freckles moles scars and even the makeup may be something that we will want to adapt as a separate layer of complexity so that you may reach out an even more complex level of characterization for yo... | 512 |
Pile-CC | us at paylessdisposal@gmail.com with a description of what you need hauling Calgary to the dump. Note: Emails are checked only once per day. Call our dispatch for immediate service. We can in most cases give a precise estimate over the phone for garbage disposal Calgary. We will also give on-site quotes for Garbage Du... | 512 |
ao3 | loud thud.
Byron did everything his brain was urging him not to, he opened the door.
In response, Rusty stood from his chair and stumbled backward. Almost afraid it was some villain coming to get him.
“Orpheus, ah.. Hi?” He said, capping his dry erase marker.
“Mr. Venture I was uh.. I was going to procure some milk fr... | 512 |
reddit | no longer slut shame for one thing. I don't have bitterness towards women and a result of constant rejection like some guys have. But the red pill? Nah, they've bastardised a good thing and taken it too far. It's full of the small minded and the vengeful. I have a love and admiration of women, the... | 512 |
gmane | aggressive caching (and preferably a pre-caching mechanism) to avoid
the latency issues
.
For me the best bet would be to get a dedicated server running CF so that
you could access the SQL directly if you wanted to or you could use CF as a
façade to manage a Web Service or XML interface to the data. It would al... | 512 |
Gutenberg (PG-19) | * *
The APPROBATION of Monsieur _Andry_, Counsellor, Lecturer, and Regal
Professor, Doctor, Regent of the Faculty of Medicine at _Paris_, and
Censor Royal of Books.
I Have read, by order of the Lord Keeper of the Seals, this _Natural
History of Chocolate_, and I judge that the Impression will be very... | 512 |
reddit | to clear your head and learn to be happy on your own. People get so caught up with finding "the one" but in reality the concept of "the one" is just that, a concept. Take your time dude, heal and love yourself first and foremost - later if she comes back and you want to give it a go then go for it, but don't whatev... | 512 |
YouTubeCommons | in your skin it's not a bogus skin brushing technique it's not a ridiculous massage treatment or weird vibrating machine and it's not some wacky diet or crazy weightlifting gym workout routine but it is real and true information that you will use right now you might be wondering who I am to be sharing this critical ma... | 512 |
gmane | air traffic management, which is a much different (and
more important) beast than providing user services.
-Wes
Not sure how many people like the build script I made, but I thought I
would let everyone know of some changes that have happened.
Well after the initial post someone registered opensoekris.com and has
... | 512 |
Pile-CC | Cooper were considered better prospects at the time of the draft.
Now I would rate them like this.
1. Justin Smoak
2. Pedro Alvarez
3. Brett Wallace
4. Eric Hosmer
5. IKE DAVIS
6. Yonder Alonso
7. David Cooper
8. Kyle Skipworth
Smoak is the most polished hitter of the bunch, and Alvarez could be a HUGE superstar type ... | 512 |
s2orc | rock, (mg (cm 2 s À1 ) À1 ). 2.3.9 Reaction rate of HPAAT. The calcium carbonate rocks were encased in epoxy resin, leaving only one side exposed for which the area (S) was 5 cm 2 . The CO 2 gas produced by the reaction of the polymer acid solution and the calcium carbonate rocks was collected using a CO 2 gas-collect... | 512 |
reddit | shadow-removed. And I guess I just don't see where I'm saying discrimination against a minority is okay. > statistically, heteronormativity is pretty accurate. It's more statistically accurate than saying "men have more upper body strength than women". > > When something is the case 95% of... | 512 |
gmane | to have the user install a random device. There's ones
out there
for Solaris all the way back to version 2.5.1
However, keep in mind that all but the latest /dev/random devices out there
do
not generate very good random numbers, the newer ones use the Yarrow engine,
but the very best ones also derive randomness from... | 512 |
StackExchange | initialized from the shared x. Something like this, for example:
x = (double *) malloc (solution * sizeof(double));
#pragma omp parallel for
for (double *y = x; ...
(x is shared and y is private by default). That serves the scenario where you want each thread to have a private pointer to the same shared space.
Note... | 512 |
StackExchange | repeated for every mailbox synchronization attempt...
It's a strange error and is easily resolved by removing the offending index file. However, I'm curious about the root cause of the error and locked-state and if there's something I can modify on the configuration side to prevent it.
In other situations, I've only ... | 512 |
OpenSubtitles | "NOT experiments" "Swine!" "Let go!" "Donevia is the main target of the anarchists." "After a bad quarter, the bad publicity does not do good." "Currently, activists are protesting in front of the head office - and require that human trials will be terminated immediately." "The new Weapons Act with firearms are illega... | 512 |
gmane |
ATI FireGL 5200 (as far as I know). I don't want to use fglrx because
I really want to use MergedFB, with which it is incompatible (as far
as I know). Is anyone working on open-source support for the FireGL
5200? If not, is it reasonable to think I could do something about it
(with no experience in this area)?
Tha... | 512 |
StackExchange | simply use a Binary tree.
Q:
how to implement a skip list
I was wondering how to implement a skip list in python.
I have made a linked list but I'm having trouble on how to create the different levels of a linked list and how i would go about iterating through every level of the list when searching or inserting no... | 512 |
reddit | parts at Missouri S&T not a bad machine but it is old and incredibly difficult to maintain. I have no idea if it is still around but there used to be a factory with a 100 or so of these running production parts
I'll look in to it. But what I am doing is probably a bit different than commercial. there is no money,... | 512 |
StackExchange |
can be shortened to
.Where(child => child.Books.Contains(Convert.ToInt32("Huck........"))
but calling Convert.ToInt32("Huck........") isn't going to hand you the Id of a book with the title "Huck........". It's going to convert the string to a number with somewhat useless results.
Q:
How to run spring boot fat ja... | 512 |
StackExchange | it isn't persistent, it wasn't of much help. Can't setup JDBCJobStore because, this will require huge code changes to my existing code base.
In light of such a scenario,
I have the following queries:
If I use Spring's built in @Schedule annotation will my jobs be persistent..? I don't mind if the jobs get scheduled ... | 512 |
realnews | of 10 oil train derailments a year in the next 20 years, as more oil is transported by rail.
"We look forward to working closely with the DOT to develop rules that make our communities and those that protect communities safer from deadly rail explosions," said Schaitberger.
Right Side News Reports from the Federation... | 512 |
StackExchange | `percent`
FROM `feedback` WHERE `booking` != '0' GROUP BY `booking`;
The key was putting the WHERE condition within the sub-query SELECT COUNT (*) (and also on the end). This means that the total to divide by is given without the '0' entries.
Q:
Float within media query not working on input after display: block... | 512 |
goodreads | her to give him a call if she ever wants to share her secrets on fighting vamps. When Val and her sister Jennifer get home Val gets in trouble from her mom and step-dad for it. What is her punishment? The kick her ass out of the house and fire her from her job at the family book store. Totally fair, right?
She drive... | 512 |
StackExchange | trying to return
["2000.10", "1276.21", "1356.75"]
This array will return all of the prices of Object 2. However, you can see that that Object 2 does not include the date of "2019-10-08", so I need to return the price of that date from Object 1. These object lengths are dynamic, but Object 1 will always be longer tha... | 512 |
gmane | sheets.
A third option would be to replace all the translatable strings with
variables, and define these variables in an external file, one file for
each language. Each report xslt file would then begin with an import of
the translatable string variables for a particular language.
Has anyone done anything like this... | 512 |
realnews | you think your past influenced your decision to work with them? Absolutely. I relate to them because of my own feeling of abandonment, struggle to survive and being touched by the criminal justice system. Writing is what healed you, so now you’re helping them heal in the same way. Exactly. Writing is so healing and we... | 512 |
YouTubeCommons | on their ship they're going to have some consideration for separating those weapons out so they're not firing at the same time because again even if you're a kilometer distance when two ships are flying at high speed one of these two weapons is destined to miss and generally speaking most players when they're running ... | 512 |
amazon | remote which is D.O.A., this a cheap alternative to some other options out there.
This Granny mystery is different from many other mysteries I normally read. I fell in love with all of the ladies and truly didn't know the outcome until the last chapter.
I highly recommend this book if you are like me looking for cha... | 512 |
gmane |
proposal for implementing IAX2 in ekiga got accepted with google's
summer of code.
To give an update (I'll try and keep you guys regularly posted as to
what's happening, any problems etc.).
Currently I have been looking at the code to gain an understanding of
ekiga and opal's code and design. Also obviously checkin... | 512 |
reddit | a camp and loot to save gear for next time you die, look for other peoples camps, PvP, and so on. lots more trees of choices are open to spend your time in the game and keep you entertained with goals. right now in standalone is gear up then maybe get some higher tear gear then PvP. once again im ... | 512 |
ao3 | him with the threat of a paddling in her gaze.
Bucky stared at him for a long moment, pale eyes rimmed in red. Finally, he spoke. “Do you want your cat’s eye back?” he whispered, still squatting as though he might have to leap up and run.
_That’s a stupid question,_ Steve nearly said, because it was. “’Course not,” St... | 512 |
s2orc | carried on conjugative plasmids and harbored by transmissible genetic elements such as insertion sequences and transposons that speed up their dissemination in bacterial community [17]. Quinolones and fluoroquinolones are broad-spectrum antimicrobial agents extensively used in poultry disease treatment. This widesprea... | 512 |
Gutenberg (PG-19) | whirlwind free;
O'er sea and land, and foreign strand,
Who would not a wanderer be!
"To the far off scenes of our youthful dreams
With a lightsome heart we go;
On the willing hack, or the charger's back,
Or the weary camel slow."
Thus sang the wayfarer to himself as he urged a potentially wil... | 512 |
gmane |
you want to add that lacks some schema component: location-less
features, etc. Using an organism called "all organisms" or
computed organism, or what ever is most appropriate is valuable
added information (or call it "null").
- Don
Hi (this has got noobie all over it),
I have set up Mandrake 10 with DHCPD. The c... | 512 |
reddit | other people. He doesn't have to play to a passive crowd, but instead has a more active participant/partner to bounce off of.
Get an FM transmitter! I have an 05' Camry and it plugs into the power outlet. You find a low station that's just static and then you set the transmitter to that station and plug the aux cord i... | 512 |
Gutenberg (PG-19) | in a high wind, for even in the most gusty storms there is no
whipping action. In the longer spans, the cables hang absolutely parallel
and sway in a most deliberate manner from 12 to 25 feet out of line.
[Illustration: HARTWELL NO. ONE.]
[Illustration: DETAIL OF DERRICK CONSTRUCTION.]
Inasmuch as fuel economy is o... | 512 |
Github | and the algorithms that work with them must limit their assumptions to the requirements provided by that type of iterator. It may be assumed that an input iterator may be dereferenced to refer to some object and that it may be incremented to the next iterator in the sequence. This is a minimal set of functionality, bu... | 512 |
reddit | only edit to the footage I did was lengthening the video by 50% in Gopro Studio. Next time I film a night time lapse I'll be pointing the go pro to the west end of the sky rather than the east. The town is east of my location which was creating the toxic light.
I wish I looked more childlike, as that is the ideal ... | 512 |
s2orc | therapeutic hypothermia and/or cooling therapy in patients with acute traumatic brain injury. The SRs were published within a small range of time (15 years) and included 0 to 37 RCTs. Two of the included SRs 21,26 were judged as having an overall high confidence in the results, with none of the AMSTAR-2 items judged a... | 512 |
ao3 | your way a scrape here, slash there, so you can retrace your steps or someone can follow more easily. Ants! Did you know that ants won’t cross a line drawn in chalk? Stops them in their tracks and they turn away.
Then there's the sound chalk makes against the board, even the smell.
The thing is try and describe the sm... | 512 |
reddit | and work.
Hello reddit !!!!, today I'm looking for arab ladies , for I'm an arab myself and having rp's with people from around the world is great , but it never hits home, so that's what I want to do today an rp with an arab lady kinks:dry humping ,ageplay , romance, incest and slow burn , and many others... | 512 |
s2orc | kettle, and be a chamber of steam-water distillation when steam filter was put in the kettle.Samples were directly contacted with water inside kettle during heating in hydrodistillation process, while in steam-water distillation, samples were steamed in the same kettle and contacted with hot water vapours only. Each d... | 512 |
s2orc | 1979), Pringsheim's Medium (Pringsheim, 1946), Allen and Arnon Medium (Allen and Arnon, 1955) and Chu's 10 Medium (1942).
Results and Discussion
Effect of culture medium on Blue Green Algal flora
All the three culture medium was tested for growth of blue green algae and observed that the all culture medium suppor... | 512 |
Pile-CC | (including nearly six in ten Republicans) found convincing the counter argument that this is not realistic. Asked how likely it is that the other permanent members of the UN Security Council would agree to this plan, a majority said that it was not likely. Asked how likely it is that Iran would agree to return to nego... | 512 |
reddit | say a special on processed ham (yea it's not steak, but it works well for sandwiches when you're hungry) buy say 3 pounds at whatever thickness suits you (I usually go thinner) and ask for them to separate them in 1/2lb to 1lb bags (depending on how fast you use up the meat). When you get home freeze all but one bag. ... | 512 |
StackExchange | would like to apply to a PhD program in France, but I am having trouble understanding the admission process. How should/could I submit my application?
Is it proper to contact the Professor I would like to work with and ask about any openings? If yes, what should I include in my mail?
I am only familiar with the admi... | 512 |
goodreads | this universe who doesn't like this.
Here you go guys!--
Official Trailer!!
https://www.youtube.com/watch?v=4sewk...
Excerpt:
I'm exhausted. I don't even want to get out of bed, but today is Breyson's memorial service. I stand from the bed and look at my small figure in the mirror. I've lost weight from the co... | 512 |
realnews | a Taser, authorities said. Shortly after he was subdued, the suspect went into cardiac arrest and died, authorities said. No officers were injured.
kelly.puente@presstelegram.com, 562-499-1305
News services contributed to this report.
DAYTONA BEACH — Despite winning Saturday night’s Coke Zero 400 at the Daytona Inter... | 512 |
goodreads | are my own. I am disclosing this in accordance with the Federal Trade Commission's 16 CFR, Part 55.
** spoiler alert **
This book fulfills the "comic written in the last three years" category of the Book Riot Read Harder Challenge-2 2016.
I enjoyed reading this book, but in retrospect, it left me with a sad feelin... | 512 |
ao3 | But, with this under my belt, I think it'll be easier. So, let me know what you think, flame policy is located on my profile and will always stand in effect and thank you so much for reading!
>
> End Transmission
Jungkook let out a soft ‘oh’ as recognition shined through his eyes. He noticeably sagged. “Already? I tho... | 512 |
YouTubeCommons | called has putter dr. Luke this monument is located next to the highway it is a complex of Hindu and Jain temple located on the west bank of malacca river in gagal district [Music] [Applause] [Music] since the previous day was too much of journey we got up late we checked out and we kept our luggage in the counter in ... | 512 |
nytimes-articles-and-comments | event, what would you suggest the Democrats do? Appeal to the better nature of Republicans? Raise the spectre of another round of impeachment hearings? Demand the invocation of the 25th Amendment?
The Murkowski playbook:
1. Make a statement about how you are "considering carefully", "thinking deeply", or "strugglin... | 512 |
gmane | clarity and might also be a
structure that we could approach the UAWG about using (For them the
third item could be something like "Additional browsing support SC").
4. We could then tighten up the old A.0.1 wording to make it clear that
conforming to WCAG usually satisfies the SC's for *user interface
"chrome"*... | 512 |
realnews | the 103-game history of the Granddaddy of Them All.
Deontay Burnett, who had three TD catches, caught a tying 27-yard scoring pass from Darnold with 1:20 left to cap an 80-yard drive in 38 seconds with no timeouts available.
Leon McQuay III then intercepted a long pass by Trace McSorley and returned it 32 yards to the... | 512 |
realnews | and are required to keep detailed records of customers' surfing habits. Like most Arab countries, Syria blocks all Israeli websites.
Internet censorship in the United Arab Emirates, another Middle Eastern blackspot, is "substantial", according to the ONI. Reporters Sans Frontieres (RSF) categorises it as "an enemy of ... | 512 |
reddit | families. The money involved in caring for a baby is crazy. The store was full of kids. So much running around and so much talking. I heard so many parents telling their constantly babbling kids to be quiet. I heard a man tell his son to have respect for his sleeping baby brother and be quiet. 😂 Lately... | 512 |
reddit | as a team. You state that you've talked to her about this, tried to find solutions for childcare, and possibly talked to her about not doing most of the household management, etc. What has been her response? If nothing has changed, and you've been absolutely clear about your needs and expectations (assuming tha... | 512 |
StackExchange | level - this is where rethrowing may be useful). All other exceptions either need to be logged so you can debug why they happened, or shouldn't be happening in the first place (for example - make sure you validate user input, etc.). If you catch all exceptions, you'll never really know why you're getting the excepti... | 512 |
Gutenberg (PG-19) | the school dates back to the closing years of the
sixteenth century, when a reaction set in against the Chinese classicism
of the Ashikaga period. This manifested itself in the choice of Japanese
instead of Chinese subjects, and in novel treatment in which features of
both the classic Kano and Tosa styles were combine... | 512 |
OpenSubtitles | these things am I doing?" " Sixty." " How many have I done?" " Three." " Three?" " Yeah, this is what I'm talking about." " Your system's slowing me down." " I don't have a system." " You're kidding?" " You ready?" "Hey, can't we have color codings and stickers, priority lists?" " Can I get a little bureaucracy going?... | 512 |
YouTubeCommons | rules of Stephen the third but the latter was forced from Rome and sought the aid of Charlemagne after two unanimous elections Charlemagne son Louis the pious intervened in a bitterly disputed election in favour of pope eugene ii thereafter the process was returned by apostolic constitution to the status quo circa 769... | 512 |
gmane | don't think we will be limited by Moore's law for
#2..
If we utilize existing technology existing in Hw and software
methodology,
we can change the game on #2.
Sue Hares
The votes have been counted. In total, 52 people have voted for one or more
categories. We have not seen any irregularities. There were no ties, ... | 512 |
DM Mathematics |
Suppose 7*i - 3*i = -4*c + 3992, 4*i - 2*c = 3974. Let h = i + 1017. Is 6/4*h/6 a prime number?
True
Is (-4)/16 - (-97735920)/192 a prime number?
False
Is 2880647/42 + -4 + (-275)/(-66) a composite number?
True
Suppose -14608 = 10*q + 13152. Let l = q - -4061. Is l composite?
True
Suppose 0 = -29*d - 28*d - 4788. Let ... | 512 |
StackExchange | known whether they can be done in polynomial time: we don't know whether PSPACE = P. If you can prove for a single PSPACE-complete problem that it can be done in polynomial time, or that it cannot, you will be famous in computing science forever. In practice, for such problems, we have no better than exponential algor... | 512 |
realnews | when cornerback Antonio Cromartie – who was returning the punt because Jim Leonhard was a bit banged up – muffed the fair catch and Leodis McKelvin recovered at New York’s 36. McKelvin injured his ribs on the play and left the game.
Fitzpatrick went for a big play right away, throwing a ball up deep down the right sid... | 512 |
s2orc | selectivity was almost 100% in all experiments, which was because separating carbon and hydrogen prevents the generation of CH 4 .
2.2. Descriptor Calculation. Data from the periodic table, Python Materials Genomics (pymatgen), 25 and the Materials Project 26 were used to represent structural information for the meta... | 512 |
goodreads | explains exactly how he knew what would go wrong. The entire climax of the book was cheapened for me by Malcolm/Crichton's preaching about the ills of science. It really caused me to slog through the later portions of the book.
I haven't watched the movie in nearly as many years as it's been since I last read the bo... | 512 |
ao3 | machines.
Inside is best the pits of hell, frames still screaming lay in pieces on the floor or hang from the ceiling, they are off all ages sparklings younglings elderly, but in the center of it all was a femmeling the only intact frame there hung by cables, she looked alive with glowing ice blue optics and a white c... | 512 |
gmane | my
Kensington TurboBall does not fully function (common on most KVMs).
HTH but YMMV
Sincerely,
R. McFarlane
So I guess I'm nearly ready to get this wiki going -- still need to find a
way to have people register, and am still reconsidering where to put the
Action Bar.
BUT if y'all could check it out and tell me... | 512 |
reddit | of the big prizes, but each person in attendance got a nice gift bag, which contained a hat, Run the Jewels pins, lanyard, Gears 4 COG, and a code for the Ultimate Edition of the game. This was in addition to a t-shirt and Run the Jewels stickers.
I will address this in the video I'll make. I'd like to make a couple t... | 512 |
goodreads | definitely recommend it for fans of the genre or those looking for a fun series about mermaid mythology.
Disclosure: I received a copy of the book in exchange for an honest review.
A short quick read. I do love Mythology. This book is about Medusa and Aphrodite. Two great characters for sure. The book kept me wantin... | 512 |
Pile-CC | their parents found out, they set him on fire and killed him...Freddy Krueger’s physical appearance has remained largely consistent throughout the film series, although minor changes were made in subsequent films. He wears a striped red-and-green sweater (solid red sleeves in the original film), a dark brown fedora, h... | 512 |
StackExchange | have to persist with reflection, e.g. to call ShowDialog method:
Dim method As System.Reflection.MethodInfo = _type.GetMethod("ShowDialog")
_result = method.Invoke(_manageComplexProperties, New Object() {_parentForm})
Q:
TurfJS dissolve not working as expected
Why are these two overlapping polygons not dissolving?... | 512 |
s2orc | wide range of aspects, including party affairs of students, student communities and associations, awards and attendance loans, school roll affairs (suspension or dropping out of school), graduation and employment, student behaviors management, dormitory management and so on. As for management nature, their work can be... | 512 |
YouTubeCommons | the teachers we had to talk with the teachers kids treated me okay i got a little special treatment you know but for the most part kids they treated me fine and when i got to high school it was a whole different ballgame when i got his popularity he was in high school dad [ __ ] high school sweetheart you kn... | 512 |
reddit | weapons because we already have a UI for attachments that are attached to a weapon. Edit: Basically I don't see the reason to have attachments that are already on a weapon in our backpack. It's just more to filter through.
Wow, that's a ton of extremely helpful input! Thanks a lot! Let me provide a b... | 512 |
nytimes-articles-and-comments | him and future presidents in check. The Trumpublicans in the Senate are on the verge of unleashing presidential power that will certainly upend our constitutional system for good. They ought to think about how future generations will get that genie back into the bottle.
@NM
Not enough has been written about Trump’s ... | 512 |
realnews | monopolies made no sense in the 1970s and make even less sense in the age of the internet and easily obtained competing quotes,” he adds.
“When governments interfere in insurance markets, in the policy that should result from actuarial calculations, governments subvert the sound basis for such risk management,” Milke ... | 512 |
ao3 | had been creaming his pants over for the last three months and it was their day, Diego had told Klaus that it was his day. Anything that he wanted was his.
And there was one thing floating in the back of Klaus’ mind.
_ Dump Jackson, be with me instead. _
But he stayed silent, only screaming when he saw something on s... | 512 |
realnews | top of the crease, where Kreider tapped it in for his team-leading 24th goal.
Subscribe to Newsday’s sports newsletter Receive stories, photos and videos about your favorite New York teams plus national sports news and events. By clicking Sign up, you agree to our privacy policy.
Host Henrik
The Rangers got together a... | 512 |
reddit | that they see all around them every day. You tried to make an underhanded concern troll jibe at someone, mucked it up with a horrible analogy, and got called on it.
They won't be doing native t2s any time soon and here's why. If they released Thanos or SW t3 next update, every t3 they w... | 512 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.